Description :
From Genome Similarity Track
Location :
Scaffold_3539:443- 1463
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_3539-snap-gene-0.0Serine protease family S10

Sequence
1020 bases(100 bases per row)
GTGTTGTTCACCATATCCAGTGCATGTTCACTCTGGATTACGGGGTTCACGAGTCCATTCCCAATTGCGATACCTTGCAAGTTCAGACGTGCTGCTACGA
CATGATTGTCGTGCTGCTTCTGCTTCCAGATGTAATGAGCCGCAGCCGGTACATAATGGCCCGCATAACTCTCTCCAGTGATATACAGCGGTCGACCAAC
GAACGCTGGATGGGTGTCCAAGAAACCCTGCAAGAACCAATAGATGTTTATCTGCACATCCGCTTCATTGTGATCCAAATCTTCATTTAGACCATAAGAG
TAACCAACATTTGTCGGCTGGTCCAACCAGATCACATTGGCGTTGTTGGTCCATGAGAACGGGTTGATCGAAGTCGTCAAGTTCGGGTACACGCGGCAAG
GACCATTCTCTCCGAGTAAGGCTCCCAAACTAGAGCAACCTGGTCCACCCGTAAGCCACAGCACCAATGGGTCGATGCTCGGGTCATTTCGGGATTCGAA
GAACCAGTAGAAGTAGTGGTCGTCCTTCTTGTTCGGGAGCTTGATGTACCCGGCATCGTTCTTCGTATCATTGCAGATCGTGACACTGTCAGCGACGATG
CCAGAAGCGATGTCAGCAACAGATACTCCCGTCTCCAGTGAATCTGTAGAAGCTACTGCCTGTAGTTGGCCACCACTTGGAGCTGCTTGAAATACTGGGA
TAACATGTGGTGGAGCTGCGCGCCATGACGAGTGGACTTGCTCACTGATGTTGGTGGCGCTAGAGCTCACCCACCAGCCTCCAATANNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNAACGGCGGCAGCAACGAAGCAGACGCCTAGCAGTCGCACAATGTGCTTCCCATGCGGTTGGTAGCGCAGCATCGCAG
CCTCGTGCACTTCGGCGAGCAGCGGTGTTCGCTTCGACGAAGCCATCCCAAGAGCTCGCTATTTTTGCTTGCTGAGAAGGATCGGTTAAAGGCACAGACT
CAGATCAGATACTACTGATC