Description :
From Genome Similarity Track
Location :
Scaffold_666:4429- 7531
Sequence
3102 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNCCAGTAAAAGTCACGACTAACTGTGAGATATGTCTTCTCTCGACCACGATGTCCACCAGTAGGTGCATCGTGGTACTC
ACACATGATGTGCAGTCGCAGGTCACCATGGTCCGGTACGACGACACGAGGCGTGCCGCCGGCAACGGCTGTATACTTCAGTAAGCCATTGTGGACTGTA
TATCTATCCGTGGAGGATCGATATACTGGGGGCAACCTTTTAAGGGATTGACGGGATGTTTGCGAGAGATGTTTTATCAAACGCACCATCGCCGGATCGT
ACGCCATGCGTATGTCTTCTAGTAAGGTTGACGACGGGACACTCGATGTCAACACCGCGACAGTGGTCGGACCAGTGTCGGGTTGCGCAGCCGGTTCGAA
ATCGGGCCGGCGCGTCAGAGCATCAGCGACGACATTCAGCCGTCCTGGTTTATATTCCACGAAGAAGTTATACTCCGCGAAGAACGACAGCCACCTCGCC
ATTCGTTGCGAGAGGTGTGGACTGTTAACGGCCGTGCGTAAGGACGCATGGTCCGTGTATACGATGAAGGGTCTATCACCTAGTAGGTAGACCCTGAATT
TTGCCAAAGCATACTTCATGGCAAGGCGTTCCTTGTCATAGACTGGGTAGTTACGTTCAGCCGGTTGCATCTGACGTGACTGATAGCAGACGACACGCTC
AACACCGTCTGTGTCGTACTGCATTAGTGCACATCCGATGGCAAAATCACTTGCATCGCAGACCACATGAAATGGTCTGTCTTGGTCTGCAATCGCCAAA
ACTGGCAAGCGTATCAAGCTTTGCTTGATACCTTCGAAAGAGCGCTGGAAATCAGCACTCCATGCTCACTTCTCGTTCTTTTTCAATAAACGAGAGAGGT
GGACAGTCATCTTGGCGTAATTATGCGAATATTTGTGCAAATACGCCACTAGGCCAAGGAACTTTTGAAGTCGTTTTATGTCGGTAGGCACCGGCCAGTC
AGTGATCACCTTGATCTTTTCCGAATGGGGCCGGACGCCGTGCTTGCCCACGATGCATCCAAGAAGTGGTATTACGTAGCAGGGGCATTACTCAGACCTT
GTGGCATTACTAGCCACTCCCAAAGCATACTGCTTGGGGTTCTCACTGCTGTATAATGAATTTCCTTTTCACGCATAAGGATCTGATAGAACCCGTCCAT
CAGATCCATCGATGAAAAGATGGTACTCCTTGACATACCATCTATAATGACATCCTTTCTTGGTATCGGCGTTTGAGCCGGTACAGTGGCAGCATTCAAC
TTGTTGAAGGCATGTACTGTCCGCCATCCTCCTGTGGCTTTTCGGACACAGAAGTTTGGAGAGAGATGTGAAGAAGTAGATTCCCTCACATGGCCCGCTG
CCAATCGATCAGCAAAGAATTTGTCAATAGCTAGTACTTGTTCACGAGGCAATGGCCATTGCTTCATGACACAGTACTTTGAACCTGGTTTCAGGTCGAT
CTCGTGACAAGTACCCTTATCCTTGGGGAGCTCGCACGGCACTGTTTCTGGGAACACATCCCTGAATTCCATCGAATAATCGTAGAGAGGATTTGTCTTG
AG