Description :
From Genome Similarity Track
Location :
Scaffold_43:442842- 445050
Transcript NameFunction/comments
Phyin_T30-4PITG_16189Putative uncharacterized protein

Sequence
2208 bases(100 bases per row)
AATCTGTCAACCAGCGGACGCTCTGTTGAATCTAAAATACGGGAAATTGTTGGCCCGCTTTCGGTTGATGTTTGTTCGCGCTCGCGCATGTATTGGCGTA
TACACTGTGTGTCTAGAGCTTTCGATGGTTTCATCTTATTGCGTCTTGGAGTATGAATCATCTCGCTGAATAACCTTTCCGTAGTTGCAGTATTTACTGC
GATCGAGAGTACTCTAATTGCCAGGTCAGGTAAAACACTTGTTGGGTTCTCATTTTTAACGTGCTGCCAATACTTAACCTTGTTAAATCGAAACTCTCTC
GGGTGCGCGGAAGACAGCGAATTATCTATCCACTCAATCATATGACTGCGAATAAAGTCGTAGTCATCACCAATTAGACGACGGTAGGAATAGACAGCAA
ATTTTGCGAGCTGTGTCGAAGATGCGATTCTGGCTGCTTTTTTGCTATCCTGAAACTGTTGTCGATGCTCTTGTTCAGTGCTCTCGTCTAGCATATCTCT
ACCAATAAGGCGTTCCTCCATCTCCACGACACGCTTTCTGTCGTCGGTTCTTTCCACAAGTTTTCTTCCTTCGTCGGCCGTCATCGGGTTCAATAAAAAG
GTCAACATGAGCAGTGGCTGTTCACATTGTTCCCAGCGTGATTCTTCACATCGAATTAGTCCACTTCGGTAATCCAAATAGAAGTTGTCGAAACCCACAA
AAATATCACGAAATGATAAAACGACATCTGCCAATGTGTTCTCGTCGCGTTGGAGCCGATATGATGACTCCGATAATGGCGCAATAACTTGTTCCGCCTC
TGTCAGCTTCCTCCAGAATGATGAATCGTTGAACACCTTCAGCGAGCTAGGGTAATCTTTATAGCCACGGTACTTGATGCTTAGCATCTCCAGCGCAGTA
CGAACTCTCAATAATGAGGCAAAACAACTCTGCATACTATTCCATCGTGTCTCACAAAGTGTAAACAACGCTAGCGGCTTGTCGTAGCATTCCTCCATCA
TGGCTCTAGCTCGGACAAGCCACTTAGCTGATGACGCATTGAGGCACTTAACGGCTGCCGTTGCCTCCTTGGCAATCCCAGAAAAAGATGACTTTAACAC
TGCTTTGACAATGTTGTTGATACAATGTGCAAAGCAGAAAAGAAACGTAACGTTAGGCCATCGTAAAGCCAAGATGCGCCGAGCTCTACCACATTGACCG
GCGTTATCGGTGATTACTGCACCAATGTTCCACCCTTCATTTTGCGCCTGCTTCAGAATAATCTCCATCTCTTGAGCCATCGCACACCGTCGTGCCGAGC
GCCCGCCTTGGGCAATGCATACGTAAGGCTATGTCCAAACAGTAACAGCTGACAACCCAATACATGCTCACGAGAAATGTTCTGAAACACGTCCGATAAA
AAGTTGACAAATCCCCCCGAACTAATTCGTATCTGCTTCAGCTTTTGTGTTTGGATGGAACGGCAATGCCCAGCATGACTCCCGGTAATGCGTCCGCCAA
GCGTCCGCCTTCCTGGTATGTAGGCCGTTATTCCAGGGCACAAGTATTCCAACAGTGCTTTCGTACATGACCGCTCGATGAACAAATCGGGTAAAAAATT
TCCGACCTGGAACTCAACCACTAGTCTTTCCGTTTCTTGCTTCTGTTGCTTTGAAAATCTTCGGTGGGATTTTGCCCTCGGGGACGCTCGTTTCGAGGCG
TTGCGCTTAGGAGATGCCTTCGAAAAAAGAAGACGCTTGTTTGCAGAACGCTTTTGCCGGCGAGGTGATCCCATGCTCGAGCTACCACCGTCGCTTGACT
GCCCTCGACAGTTTTCCATGACGGCCCGATATGCTTCACATTTGCGCAAATGTCCAACGTAGTTATACGAGCGTCCTAGGAGTAGCTCAGGTGGGTCAAG
GTCGGGATCCTTGTTGTAAGCCAGCGTGCAATGCTTGCACGTGTAGTACGAATACTTCCCCTTGCTTTTCGGAGCGTCCTTCATCAGCGTAAAGTGGTCT
CGCTCTGATACATGGGGTCGCACCATGTTCTGCTCCAATTACCACCTGATAGCTCGCTAGCCACAAACGCCGATTGACGGCCACTCCAACGGATTCAAAC
AAGTAGACCAACACGGACGCCGATGAGAGCACGTACGAGAATGCGGACGCAGCAGCGGCTCCGGACAGTGGCAGCAGAAACGTTATTCAACACGGACGCC
GTCGAGAC