Description :
From Genome Similarity Track
Location :
Scaffold_223:44270- 49698
Transcript NameFunction/comments
Hyaar_Emoy2812880hypothetical protein

Sequence
5428 bases(100 bases per row)
TCGCCCAACGAAGGGACCTCGTGGTGATGGTACGGGCGGAGACGACCAACATAAAACGTATGATGCGAACGCATCCTGCGAGGCAACTCGATCGTGTACT
CATTGCCTTTCCGATGTAGTACACGAAACGGACTGATGTACTTGAGTAGATGTTTACTACTACCCATATAAGTTACTAAGTGCTTAGGTAGACTTATCGT
GAACAGTAGAACTAAGTCTCCAACATTAAATAGAAGAACGTTTGCTCTTCCATGTTTGTCAGCGTTCCATTTCTGCCGGTCAACCGCGTTAGCGATGGAG
TCTTGCACGAAACCGACCACTGCTTCTCGTACCAGCAGGAAATCTTCTGCTGAATCACTTTGGTTTGTTGTAGTGCTCCTTGTGCGCACCGCTAGGAGGT
CATCCTCTTTTTCAGCAAAGATGTTCTCATCCTCGCTGGTGTAGTCATTGGTGATGCTAAATGTACCAGCATCGTCAACCTCATCTTGGTCAGCAATAGT
GTCATCACTGTTGATAAGGTTATCAGCTTCGATGTCGATTTGATCGACATCGGCAACGTTAGCGTCGTCGATTACCTCAACACGTGATGGGCAAGAGCCA
GAACGGTTTTTGCTCGAGCGAATCCCTCCCTCCTTGAATTAGTGTCACACTCTAAATGGGTGGGTAGGCGTGAATGGCGTAAGCCGTTCACGAAAAATGG
TGTATGCTTTGTCGATGCATGCACGGAGTTGTTGATTGCAAACTCCACCATCGGCAAAAATTCGCTCTAATCTATGAAAGATTGGACGTATCCTCTAAGT
ATCTCTTCGAGGACGCGGGTGACGCGTTCTGTTTGACCATCAGTCTCAGGATGGTCAGAAGTAGACATAGTCAGACGTGTTCCGAGGGATCGGAATACAG
GTTGCCAAAACGGCACCGTGAACTGAGGATCTCTATCAGAGACTAGTTCACGGGGTAGACCGTGGAGTCGTAATACCGTGTCAATGAAGACACGGGCACA
ACCATGTGCTGAGATAGACTCATGAACTGCAGCAAGATGTACCATCTTGCTGAATCGGTCTACGAGCACAAAAACACTAATGATTGTTCTTGTGTGAGCT
TCTTCGGGGAAACCGAAGACGAAGTACATCGAAACAGACTGCCAGCACTCTGCTGGGATTAGTAGAGGCTGTAGTGGCGCACGAAATGAAGGAATGGGCT
TCACCCGTTGGAACACTTCACAAGCACGAATTTACTTGCGCACAAACTGATACTGACGGGGCCAGTAAAAGTCGCGACTTACCGTAAAATAAAGCCACTC
ACGCCCACGATGACCACTAGTTGGTGAATAGTGGCACTCATACATGATGCGTAAGAGCGAATCATTATGAGTGGGGACGACGACAGGAGGTTTGTCGCCG
GGAACGGCTGTATAATACATCAACCCGTTGGGTGTGGTGTATCGATCCACGGAAGATTGATACGAGGCCGGTAAATCTTTGTGAGATTTACGAGACGGAG
TTACCAGATCGGTATTCATTAGTCGCAGAAGAGCCTTATCTTCTGCTAGGCCCTTTTTATGTTGTCAAGAAATGTTGACGATGGGACACTAGTGAATGGT
GTTGCAATATTGGTATCAACCCCACTGTTGGACTGCGAATCCGACTTGAAATCGGGATGGCGCGACAACGCGTCTGCGACGACATTAAATCTTCCGGGTT
TGTACTCCACGGGGAAGTTGTACTCCGCAGAGAAAGACAGCCACCTCGCCATTCTTTGCGAGAGGTGTGGGCTGTTTACGGCCGTACGTGATGGCGCATG
GTTCGATTAGACTTCAAACGGCCTATCTCCAAGGAGATAGGTGAGAAACTTCGCCATTGCATACTTCATGGCAAGGCGTTCCTTGTCATGCACTGAATAA
TTACGCGCAGCCGATTGCAAAATCGCTGGCGTCACAGACCACATGGAATGCTCTGTCTTGGTCTGCAGTCTCCAAGATGGGCGATTATGTCAAGCTCTGC
TTGATACCTTTAAAGGAGCGCTGACAATCAGCGTCTCATGACCACTTCCCGTTCTTTTTCTAAAGACGAGAGAGGTAAACGGTCATCTTGGCGTAGTTGC
GCGAGTACTTGTGTAAATACGCCGCTAGACTAAGGATCTTTCTTAGCCCCTTAACGTCGACTGGCACAGGCCAGTCGGTAATCGCCTTGATCTTTTCTTG
ATCATGGCGTACACCGTGTTTAACCACGATGCACCCAAGAAATAATATTTCGCTAGCGGCAAATATACACTTCTTGAGGTTGGCATACAGCTTATGCTTG
CGCATAAGTGTAAGAACCTGACGAACGTCTGTTCTATGAACGTCTACGTCCGTCTTTCCGCCCATAGCCCGGCTATGGACGAATACATCGTCAAAGCAAC
TCGGTGCAAAGTCTCGCACCGGTCTCAAGAGATCTGTGACGCATCTGTTGAAGGTGGCAGGGGCGTTACTAATTCCTTGTGGCATTACTAGCCACTCCCA
GAGCATAACGCTCGGGGTGGTTACTGTCGTGTACGGGATGTCCCGTTCACGCATTAGGATCTGATAGAAGCCATCCATCAGATCCATGGACGAAAAGATG
GTACTCTTTGACATACCATCAATGATTACGTCCTTCCTCGGTATCAGCGTCTGAGCCAGTACCGTTGCATCATTCAACTTATTGAATGCGTGCACTATCC
GCCATTCTCCTGTGGCCTTGCGCACACAGAAGGTCGGAGAGCTGTGAGGGGAAGTTGACTTCCTCACATGACCCGCAGCTAAGCGATCGGCAAAGAATTT
GTCGATCGCAAGTACTTGTTCACGAGGCAGTGGCCACTACTTCATGACACAGTACTTCGAGCCCGGTTTGAGCTCGATTCCATGTCGAGTGCCTTAATCC
TTAGGCAATTCGCATGTTACGGAATCAGGGAACACGTCCTCGAATTAGATCAAATCCTTATATAAAGGATTTGACTTATGTAACTTCCAAGATTGAGACG
TGTACCGCTCAATCCGTGTCTTCTCATCGAGGACACTTTCGCCCATCGATGAGATGCTGAGAACCCGTTCGTTCTCGGCAGATATACTCCCGACCTAATT
TCAGTCACGAACTCGTCCTCCGTGACGAGTACACAGATCTGCTTGACCTTTCCACTACGCAGATCTCGCAAGAACCGTTTCGGTTCTAGCGTTGAAAATT
GAGTGATCTCCGAAGTCAACTTCGAGGCGCGATCCGATCAAGTGTATAGGTGCCTACACTTGACCCGTCATTAACCAAGACATTCAATGTCTCGATTTCC
TCCTGTAAACCGTTTTCCACAGGCTGATGAATACTTATTCCTTCAGGATGATGAGGTCTCATTCCCTCACCAATAACTGCTTAAGCAATTCTTTCCTCAA
GTATTTGGGGACCTATTCCCTCGACGTCTTCTAGCTGTGGTTGCGCTACCACAGCTAGGTCCTCAGCGATCGACTCTTCAGAAGATCTAGGATCATCGTG
TTTCCCTGTGTAGGCAACAATTTTATTCTTACTTGGATGTCACCCGCTAGGCGTACACCCATGTCCCGATCCACTTAACTTGTTCGAGTGGTTGACCTTC
GGCGCTGCGTGTGCATCCGCACAGCCGCCGGCAGCTTCCTGCACAGTGTGATCGGTTTTCACACTGTGATCTTGTGCAGTCGTACTAGCGACCGTACCGC
AAGTGAGGCCATCGCACTCACTTGCAGTACATCCACACGCTTGTTTACTCTCCAAGACGTTCATCAGATAGCCATCTAATGAACAACTGGCAGGCATCTT
CACGGTTCGATACTTCCAGCTGACCCTTGGCTCGTACCTTCTGATGTTATCCAAGGGTAACCCTTGGATAACATCAAATTTGTCATACAAATCAAGTACG
ATGAAATCATCATTGTACTGCAAATCTTCTAACTTGTAGTGAAATACTACTACACGTTTCATCACTGCTATCGATGCGCCTGTTGCGAGGCACAACTTTA
GCCTCGTAGGAGGAGTAACGCGCTCAACGAACTTGAGCCTGCGATCCTCTAGTGACTGGCGACGAGCAAAGTTGTTCGACGCCCAACAATCAACTAAGGC
ACGAAGTAACAAATCTTTTGTCACTTCTAAATTCAAGGTGATGAGGGGTACCTCATCACCAAGTTCAGAGACACACAAGGATTGTGAACCTGGAGCAACT
TTCATCAATAGATTTGCAAATTCTATTGAGGTTGCTGGATCAGTAGGGCGCTCCGCCCCTACTGACCCCTACCGTTTTTGGCGGTCCGCCACGCTGTTGT
GTCTCCGCAACAGCGTCGGACCCGCGTCCGTTGCCCTTGTTGGCAGACGGTCAATCACTTCGCTCAGTGTTTCGAGACACTGGGTGTGAAGCTCTACACT
CGTAGGCGTAGTGTCCTAACTTCTGACAGCGATTGCACTTTTGCAATCGCTTACTGCTTAAGGATAGAGGTCTCTCGCTCTCAACACGGCAGAGGTTCAT
TTGGTTCTGAACCTCCCGCCTCTGATCGTCTCGAAGGACGATAAGGGGTCAAGCTAGTGTGATCCTGTCTCACACTGATTCTTCCTGCACCGCAGTTGTA
ATCGCTTCCTCTAGCGACTTCAACTCGATGCGGAATAGGTTGTTCCTCACGGAACCATCTATGAGGCCCTGTAAGAATATCGTGATCAACACGAATTCAC
TTACAGAGCTCGCTACCATGCAACTTGCAAGGTAACGAACATGCTGAGCGTAAGCGTGAACGTCATGCTTACCTTGTTTTATCTTCAGGAGCTCTGAAAG
AGTCCTGAACTCAGATCTTGGCGGCTCAAACGTTTGGCTGAGCAGTCTTAAAGATCACCAACGATCCAAACGTTTGGATCGTGTAATTGAAGATTGAGGG
CCCAAGTTCTGGCACGCCCTGGAAAATTCTATCTGGCAAATGCAACTCGTCGATGTGGCAAGCCTTAATGGCGTCGTCCACTTTGAGGAACCATCTCAAC
ATGGAGTTTTCCTCGTCTCCCCGGTACTTGGAGACTTCTAACTTTAGAGTCTCACGTCGACGCTCACGTGTCGACGCTGCAGTAGCAGGCTGAGACTATT
TTTGCTGTCTCAGGAGCTCAGTCTGCTGGTGACCGTGCTGATACAGCAGGGTCGCTTCAGCTCGCGACGCGTCAAGTTCTCGTTGCAAGAACTTGGCTAG
TATGGAATGCTGTTGGTCCCTATCTCTTTAGTATAGCAGATACCAGCCAGCTTCTTCTCCGACGGTCGAACTAATTCGTTCGGCCGCACTCCATTCGTCG
TCGCTCAAATAGGAGTAACTTTCACGTGTGCTGTGCAAGGTGTCGTCGCCTTCGTCGTCCAACATGTTCATGTTGAACGGGTTTTGAGGTCCTTGGACGG
ACTACAAAGTGCTACCAGGTGTAACGGG