Description :
From Genome Similarity Track
Location :
Scaffold_2037:4427- 5481
Transcript NameFunction/comments
Phyta_totarag14031hypothetical protein

Sequence
1054 bases(100 bases per row)
AACAGCAGTGACACCGTATCCTCCGCGACTTGGCTCGTGTTGATCGAATTGACCGGCCACTGCAACTCATTCGCGAGTGCCGGCCAGTCCGCCTGTCGCT
TGGGCTTCGGCGAAAACAGCTGCATCCATTCGTCATTCTTCATCAGCGTTAGCACACGTTCGAAAACGCGTTTGGCCGCTGGTGTATCACCGTTGATGGG
TGGACGAGGAGCATTCAGCAACGCTGAACGCTTGCCACTCGCCACCGAGGGTTTAGAATCCTCGGTTCCATCGTCAAAGTCGTCATAGTCCGGACCCGCC
ACGTCGTTCAGTTCTTCAGTGAGGTTCCTCAAAAGAGACCTCGTCGCACCGCTAATCCCCGACGATAGGGTCGCCGTCTCCGACGTAGTCACATTCAAAT
CCGGTCCTGGTGCTGGAGTCTTGTCTTCATAGTCGTCATCATGGGCGTCGGGATCttgcttctcgtcgtcctcgaagcTCACAGAGAGTTCAGTGACAGC
TGCCATGCGGGCAATCGCACTGTTCTCTCGCCGCGTGCTCCGCCGGACTTGGCTGGAGTAGCTGGTACCGCTGCCGATCTTTTCGCCATTTTTCTTggtt
tttcttcttcttcttcttctcttggTTGCTCGTAAAACTGGAAGGCAATACAAACGATTCACAAATGGCCATACCCTGTTCCCGGGTCGCGGCGCCAGTT
GTGGTGTTGGAAATCCCACGTGAACCTTCGCTACTAATGCAGCAAGCTTATTCCCACAACAATACGTCTACCCAAAGGGCAAACGAGAGTTCGGGCTGAT
CTGAAGACCCAGATTCTGCCCTTGCACCGGGACAGACTGGACCTCTGTGATCTCGCTTGTATTGGCCAACCAGTAATACACCCACACCCTACTAGCACGA
GCAACGCTAGCAGGTGTGCACACTAACTTGAATCCTCGTAGTCCCAACAGCTGAAGGGTACTAGGCCTGATTAAGGCTTATACGAGGGCGCCGAGGATTA
ACCTCGGCTGGAAGATATATAGGAGGCAATACGCACTCCTCACACGTGCAAATA