Description :
From Genome Similarity Track
Location :
Scaffold_12:442617- 452586
Transcript NameFunction/comments
Phyra_75387predicted protein
Phyra_71302Ric1 protein
Phyra_94145AlNc14C23G2360
Phyra_75389Hypothetical protein
Phyra_71303PREDICTED: uncharacterized protein LOC101219154
Phyra_71304zinc-finger containing protein, partial
Phyra_75392Hypothetical protein

Sequence
9969 bases(100 bases per row)
AACAAGCTCGGCGCGTATGTGCCGCCGTATGGCAGCACCTCCAAGTGAGCTCGAAGGATGAGGGAGGAACCACGTTGCCTGGAGTCAATCGCACAATACT
TGGATGGTAGCTAGCCATGACCACAACGGACAAGAACTTGACGCTTGCAATGTGAAAAGGCTGTGTCATGCCCTACCACTTTGCTTCGCCTTGAGTTTTC
AATTTCACGACGAAGACTTCGCGCTTTGATTGTCAGCATCGCACTGACGGCCCGGACAGCGCGTTGGTGACAAGATCGTTGCCTATACGCTGAGAGCGAG
CGGCTCGAGCACCCTGCTAAAAGGTCGTGCTGCGTCTGCACTTGGTGCCGTCTTGGGAGACCCATTTCGGCTCGTACATACGTACGCTTCGACTGTGACA
GCAGCAGCGATGGCTGTGGGAACGTTCAATGCGCTTGCAATATGTGACGTGTGAGACCTCTTTGCAGTCTGATTCTTGCGTCGGCTGCTGCAGATTGCGC
CACGCATGGATACACGGCGCGTCAACGCAAAAGTATCCTGCAAATCGTCGATCACTTTGATCCCCCGGTCTCCACTCGTTCGGTCATTTCCCAATCGGAC
TCAAGCCTCCACGTCGATCGAGTGACGTTCTTCATCGGCCATCCGCACCTGTGGAAGCAGGCGGCCTTCCCGCTGCTGCTGACGTTGGCCTTCAGCATCC
TGTCGGTCTTCCTGCTCTTCGCCTGGACGCTGCGTCCGCAGGAGCAGTGGGTGGCTGACAAGGGCCTGCCGTCGGTTTTGTCCTGGATCTTCGCCGTCAT
CTTCGTGCTCGTGGAGATCTTCTTGCTCACGCTCGTGTACGCGTTCGTGGTGCTCGAGTTTTTCAAGGACAAGATCTTCGCCTACGTGCTGTGCGAAAAG
GGCTACGAGGGACTCGTGGAGCGCAAGACGCAGGAGTCGGCCGTCGTGCGCGTGTGCACGTCCTTCTTCCGCCTGGACGCCATCTTCCACCTGATCCTGC
TCATCGTGTCACTGCCGCTGCACCTGATCCCGGTCATCGGCAGCATCGTCTACGCGTGGCTGCACAGCACCTTCATGGCCTGGGAGTCGCACCTGTACTA
CTTCGACCTCAAGGGGCTGAGCTTCAAGCAGCAGCAGCGCTGGATCGGCCAGCGCAAGTTCCAGTACACGAGCTTCGGCTTCCAGATGCTGCTGCTGCAG
ATGATCCCGCTCATTGGCCCGCTCTTCATCTTCACCAACACGTGCGGCGCCGCGCTGCTGGCAATCAAGATGGAGCGCGAGGGCGGCGACAAGTGGGTCG
ACGACGAGGACGATGAGGCCCTGCTGGCCGGCAAGAAGACGGGCGTCTACGGCACGGTCTAAAAAACGAAGCAGTAGCTACAAAGAGAGAACGCAGAGTG
GCAGGTAGGAAGGAGTAATTGCCACGAATATGATCTCGTTAGTCTTTATCACTGCGTATTGAACTCCATTCTTGGTATCGGCGTGGCGGTGTCTTCAATT
GCAGCAAGTTGCTGCAATTGAAGACACCGCATCTTGCTGCCAGCAAGATCGGATCAGCCCGCGATCTTTTGGCGAAGTGTATCCATATCTTATGTTTCGC
CTTGGGATTGGCGAAAAAGATGGTGTAGCTGATTTTTGTCCGCCAATCACGGGTCGTGAATGTGTACCCACACTGGAATTTGTACCGATACACCAGGTCA
GAAGTTGCGGAGCACCGCACGCCATGTGCTTGAAGAGCAGACACTCTGTTTTGGCCTGCGCTGTCCCACCGCAGAGCCACATCAGAATGTGCTTGCACCA
GTGGCACGGGGAGAACACAATGATAGCTTATCACTCACCGCGAGATGCCATTGCCACAGGAAGCGGGCGCCATATCCAGGGCCACTGCGACACAGAAAGC
GATGGATACTTTCTCGGCGCCTTGTATCGCGGCCGCGGATTGGCTCACAAGCATCGAAGCCAATCAAAATCGGCAGCTGGAGCGCCCATCCCCCTCCCCC
TTTGAATGTGTCGCGTATATAGAGGTCCCTCTCAATAAGGGATCCGCATTGTTTCGATACCCTTTATAAATGTTCATCGATGCAAATTTACTCAATACAA
ATATTCATGCACCTATCTAATCCCTCTGAAATCGATTCGATAACGCTCTGAGCTTATTGAGAGGGATCTCTGTACTAAAACCAAGTCGGAGAGAAAAGAT
AGTCACCCACGGAGCCAGCGCTGCCGGACGGAAGCCGTGCACTTTCGAATTTGCCCAGCAAGTCCCAGTCTCGTTCTCCTTCTCCATTCCAAGCCAACAT
GCCGATTACCTGCGGAGACATCCCTCGCCTGATCTGCTCGGTCATCATCCCGCCCGTCGGCGTCTTCTTCCAGGTCGGCTGCACCAAGGACCTGGCCATC
AACTGCCTGCTCACTGTGCTCGGGTGCGTCTTTCAGACAGATTCCTTCGCATTTGGTCGCTAGATCCTAACGTGTTGCGTGTCAATTTCCACAGTTACAT
CCCCGGCGTCATCCACGCAGTCTACATCCTAATCAAGGAATAGGCCGGCGCCGCATCGAACTGAAAAGATGTGGCGCGGCCGTCTCTGAGTCCGCGACGG
CCGGCTGAGGCTCCTTCAGCGCAGCAGCGTCCTCCGCTTTCTCGTACAGTGGCGGCTCTCGGTTGTGGACCCTTTCGCACATTGAAGAGGAGTGCAAACT
CTCGTACAATGGCGGAGGTTCTGAAGCCGTAGACGCACATTGAAGAGGAGGGCGGACAAGGGGAAACAAACTGTCGCTGCTTTTTGAAGTCTCAGCTGCC
TGGCGAGGACCAAAAGTTAATATAACAGATCGATCTTATTCCTTCCGTTTCGTCTTTCGACAGTTGAGACGTGGTGTTGTCGCTTTACGTCAACGCTAAC
TGTCGGATCCGCGTCAACGAAGAGATCTTTTTGGCAAAGCTGAAGTTGCTGTGCAGAGCTCAAAAGTGAAGGCAATGGGCCACGCTGTGGACGATGCAGA
CACTTGGTACGAAGGAGACGAGGGTCGCTCCTCCTCGGACGCGTCGGCTTTCGACTGGGACAAGACGGCGCGCTTGATCTGCGCGGTGCTGCTGCCGCCG
CTCGGAGTCTTCCTGCAGACGGGATGCAACAAGGACCTGGCGATCAACGGACTGCTGACGATTTTCGGGTGCGTTGTAGTATCTTGCGCTGTGCACGTTG
ACGACGCTGATTATGTATGCCAGCTACGTGCCCGGGATCATCCACGCCGTCTACATTATCTGCGTGAGTTAGCTGCGGCTTGATGAGTAGCCGAGCAATG
CACGCATGAATAAACAGTAAACGAGAGATTGCAGTTTCCACTCATGTTGACGTGACTCATCTAAAAGCCACAGAGACAGCCGGCGAGTTTCTTCTTGACC
TCGTTGATGATCGTCTCTGCGCGAGAGTCCAGCTCGCTCCACATGCTAAGAACGGATGCAGGTCCAACGATAGAGGCCACAGCGTACAGATGATCGCCCT
CCACGGCTTCTGAGCTCAAATTTGAAGCGTGAAGCAACAATGACCCGCCGCCAGAGGCGTTCACCTCCCTCACAAGTCGCTTGGTCAGCTCGTTCATGTC
CACGTGATGGTGGTGACGAAGCATCGCCTCATCCAGCGTCGAGGTGGGGCACGTAAGGCGAAATGCTACCGTCGTAGCTTGCTCAGACGCTGCCAGCGTT
TCGAAGCGCTCGTCGGTCTGCAACTTCGCAAGACAAGCGGTACGGGTCGACTCGGTCTCAAACTCTTCTGTAGGTTTGGCCAAGCACGTCTCAAGACTCG
CAAGAGCTTCCACCTCATCGAAATGCTCTCCGTTGCTGGCACTGCTGAAGCCGATCACGACAAACTGCGTCTTTGGGGTTGATTGCCAAACTCCAGCGTT
CTCGACTTCCAGTCGTCGCTTGCCACTGAGCTGCACCACGAACCGATATTTCGGCAGCTCGGCAATGTACATGACCCCCTTCGCACGGAGCGTTCCTGGA
GGCAAATGATGCTGGATCCAATCGTGCACAGCTGCCAGTGGCGTGGGCGACGTTTGCTCATACGCCACCGATGCAAACGCCTGCCTCAAAGGCACGACAT
CCTCCTTCACCTCCGCTCTCTCCACTCTCAACCGACTGGGAGCTGGAGTGACGGCACTATTCAACGCACTCAGCCCCGTGTTCCACTGGACTTGCACGTT
TTCATGACTCACGCCACCATTGAAAATATCTTCGGGCGGGGCGATGTCCAGCACATGGGGTAAGTACACTTGGCCATGGTCCGTCTCGTAGACTCTCGCA
CTAGGAGCGTACTTGGCAATCACGTCTCGTGCAGCTCTCAGCTTACTCTCGTCCAGTAGATCCACCTTGTTCAGCAGCACCACGTCGGCGCACTTTAACT
GTCTCACAGCCACAGCACAAGGCTCGACGCCGTTCGAAGCGTCCTGCGCCACGGCGTCTCCGTCCACCACGGCCACCACCGAGTCCAGTCGGGCGCGTGT
CATCTGGCCGAACTTCTCCTGCACCGCGGCCACCAGCTGCGTGGGGTCCGTCACGCCGCTCGTCTCCATGACGAGGTAGTCCACGTCGTCGCTCAGCACC
TGCCACACGGCGTCCTTGAAGGCGGCCAGGCTGCTGTTGGGGTCGGCCCGCAGCTCCAAGAGCTTGTTACCCTGGCCAGCCACCAGGATCGCGTCCACGT
TGATGGCCGCCAGGTCGCTCACGGCGCAGGCCACGCGCAGGTTCAGCTTGTGCTGCAGGACGTGCTGCAGCAGAGACGTCTTGCCCGCGCCCAGGAAGCC
CGTCACGATGGTCACAGGCAGTCGCTTCTTCTGCGCGTTGCGGGCCAGCAGTTGGCGCTCGGCGCCCAGGCAGAGATTCACGCGCGTGGCCGCCAGCTCC
AGCTCCGTCGTCATTATTGGGTGTTTTGAAACAGATTCAGAAGGGTTTAGAACGGACTAAATCGTTGCAGGGTGATGGCTCGTCCCGGAGGAATTCCTCC
ATTGAACTTGATGTCGTTGGACATTGGAGAGCAACGCTGAGCTGTTGCCTCACTGTGCAATTGACCTTCTGCCACGCTATAACTGAAGTTGTTGCTACGA
AGCCATGGCCATCACGTGGGGAGATTGTCCGCGTCTGATCTGCTCCATTCTGCTGCCGCCACTCGGTGTGTTCTTCCAAGTGGGCTNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCTCCACACTACACCGACAAGGGCGTCTCGAATGAATATCAAGCAGCGCCGCAACCTGCAGTT
GACTTGACCTCCGCCCGTTGTTGCCTTTTGACCAACATTCCTCTTCGTAATGCTTCGTTTGTGTTCCCTTCGCTGGTCGCGGCAACAAACTTCCTCTTCA
TTGTCCAATTCTCCTCGGACAGCAACTAAAAACCCCCAATGGACGACCCTTTGGTCTCGGGCGGCTTTATGCTGCTCATCTGTCTGGGCGTGACGGTCGT
CATGCAGTGCAGCTTCTTCGTCGTGGCGTACACGTGCCAATTCGACAAGGTGACGGACTTGGCTGGTGCGCTCAACTTCATTGTGCTGGCGGTGCTGTCG
CTGGTGCTGCAGGGCGTCTACGACACGCGGGCCATTGTGACCACGAGCCTGCAGGTGGCGTGGGCGCTGCGTCTCGGCTGCTTCCTGCTCGTACGCGTGC
TCAAGCGCGGCAAAGACGCCCGCTTCGACGAGATGCGCGCCAACTGCACGGCGTTCTTCGGCTTCTGGGTGTTCCAGATCCTCTGGGTCTTCCTGGTCTC
TCTACCGACGGTGTTGGCCAACTCAAGCGGTGAACGAGAAGACAGCAGCTTCGGAGAGCCGCGGGACATCGTAGGAGTCGTGCTGTGGGCCGTCGGACTG
GCGGTGGAGGTCGCCGCCGACACGTCCAAGTCTGCGTTCAATGACGAGCCCGCGAACAAGGGCAAACTGCTGCGTTCGGGCGTGTGGAAGTACTCGCGCC
ACCCAAACTACTTCGGTGAGATGCTGTGCTGGGTGGGGGTTACGATCGTTGCCAGTGCCAACTTCGGAGGCGAGACGTGGTTCTATTGCGTGAGCTGCAT
CAGCCCCATCTTCACCTTCCTGGTGCTCATGTTCCTCTCGGGCGTGCCACTGGCGGAGGACCGCTACGACGAGCGCTTTGGTTTGGACCCGGGCTACGTC
GAGTATAAGCGCTCGACCAGTCCGCTGGTTCTGTTGCCTCCTGCCCTCTACCGCTCGATCCCTGACCCGATCAAGCGCTGGTGCTTCTTCGAGCTGGACA
GATACTCGCGCAAACTGCGAGAGCTGCGCGACACCGAGCACAAGACAAACTACCAAGCCATCCCGTAGAGTTTCCTAGTAACAATTACATGCAACCTCAA
AACTCCGGGATTCTAAAGAACAAAAGTCAATTTCTATAAGGAAAAGGGAATACCAAGAGTCTACACCTTCTCGAGCTTCTGGAACTGACCACCGCCAGGG
TTGAGGCGCGCCAGTTCAGCGCGGTCCGAAGACTTAAAGTCGAACGTGCATTTGTGCTGGTCTGCGTACCGGTGCGCGCCGCAGAAGACGAAGCCGCAGC
GGCAATCGATGGCCGTGAGCGTCACCTTCTTGCGGCACTCCCAGCAGCGTTTCTTGTTCTTCTGCACGGGCTTCTGCTCCTCCTGCTTCTCGTCCTCCTT
CTGCACGGGCTTTGGCTGTTCTTCTACAGTCTCTAGCGGCTTGGGGGTCTCCGCCTTGTGCTCCGTGGCCGCCTGACGGTCCGACATGGTCTTCTTCCAA
CACACGGAGCACATGCCGCCGCTGCCGGGTGCGCCGAAGAAGCCGCAGCCGTTGAGGCAGAGCTTCGTGGTGGCTTGTTCTTGCTGCATCGCGGTCTGGA
CTGGAGGAGAGGGGCTTGAGGCGTACGCGGAGAAACGACGAATGTCCAGGGAGAGGAAGAGGCAAGTCCAGATGGCCTCGCGATCTGAGAAAATAGGAAA
CGACGCGGTCGGCCATTGGCTGAAATGCGCGGCCAATAGAAACTTCTAGAAAGCGAGATGGACAATGTTGTCCATCTCGTGTCGTGCTGCCATTTTCGCA
TCGGGTCATGATGGCAAGCATTCCCTAGCCACGAAGGATCTCTCGGCTGCGTACGGTGCCATTGCGCAATTTGCATGTTTAGAAGCCCCAGTTCTTTTTC
TTGTGGCTCTCTAGCCATAAGAGTGTTTGGAGGTCCAAATGCTCTTGGAAACTCCTGATTGTAAAGGTTGGAATGGCTGGCACGGAATCTGAAAAGCCTC
ATTGTACGTCGCTGCCTGCTTCTGTTGTGGAGGGCCATGACTGCAATGCTACGAGAACGCACAGAAGGAGCAGCAATTGCAGCGTTGACAGCTTCAAACT
GCAGTCAGTGAGCGACTAGCAAAACGCTGCCGACTCAGCCACGCATGCATTTTTGCAGTCCGGCCAAGCTGCTGCCTTTTCCTAGTCAGTGGAGTCTGCT
GTCAGTGCCAGGCATCAACGTCTCCTCCATCATACAACTCACGACGTGTGACTTCCTTCCAGCTGTGTCTACTCGCTGCTTGGTGTACAGTCCACCGACC
AGCTCAGCCTCGGTTTGATGACCTTCGCCTGCACACCAGATGACCCGAGTATACATACTCCAAGTCACTCGAACCCTCGCCGTGCCAATGTCAATCGACA
AGCCATTTGACCTTCCTCCGCCATGGCGTCGAGTCTGTCGGCCGTGCAGTTCAGCGCCGCGCGCCGCGAGCAGCTCGACGACCAATGCGACCTGCTTCTC
GAGCGCGCGCTGTCGGCCCACGACAAGTTCCACGCGGCTGCGCGGCTCGGTGGCTGGCAGCGCGTGCGGCGTCGCAACGCCATGAACGTGTACCGACCGC
GGGTGTCGGACGGGCCGCGCGTGCTGCTGGGCAGCGGCATCGTGCCCGGAACGCTAAACGATGCACTTAATGGCGTGTACTGCGACTCGACCGAGAGCCT
GCGCATCTGCAAGAGCCTCTTGAGCGACAAGTTCGTGGACGGCGCCGTGCTGCGCGTGTTCGAGGCGCACGAGCTGCATGCGCCCGTCGTGTTCGCAGGC
CTCAAGTGGTTTGTTATGCGCGGCTTCGCGGGCTCCAGCGGCCTGCTGAGCGACAAGGACATGCTCACGTACGAGCGCATGGGACGCATCGTGGACCGCC
ACGGACAGATCTTCGCCTACCACGCGCTGCAGTCGGTCGAGCTGGCGGAGCGGCCGGCCAATCGAGAGCGCGGCGTGCAACGCGTGCACGTGTCGTGGTG
CTATCTGTACCGCCAGCTGAGCGCCGACTGGCTCGGTGTCTTCATGCTGGGGGACATGAACCTGCCCACGATGATCCCCGAGAGCATCGCGAGCTTCATC
GCAGCCGAACGAGTGCTCAGTGCAGGCAATTTCCTGCGTGTGGCGCGCGCCAAGCACTTTTCAGCGCTCATGGCGCAGAGTGCACAGCGGACAGTGGAGG
ACGGCGCCCCGCACTGTGTGGTGTGCATGAGCCCGCCCCCGAAGATGCTGGGCTTCGCACATAAGCTCTGTATGGGGTGCCGACAGCACGTGTGTCGGAA
GTGTCGGCAGCGACGCTCCGTGTTCCGCCTGCAACTGCGGTCGGCCAAGCCGGCCACCGAGTACTTTTGCCTCTTGTGTGTGGACAAGGTGACTCGCCAC
GGAGGCGCCAAGAGCAGTGCGGGGATCGAGGAAGTGCACGGCGTGTTGCGCGGGTCTCGGTTGGGGTCCTCGCGGTCGGGCATCTCCGACAGTGGACGGC
AGCAGACCGAGTGGTCCGGGTCCAGGTCGGGGCTCAACGAGTCCGTGCGACTCGACAAGCTGGCCGAGTTCACGCGGCGGTGCCACAACAGCATCGCCAT
GGACGAGGACACGATCAAGTGGAACCAGGAGGAGCTGCTGGAGATCACACACTTCCTCGAGAGCTCCAGCAGCCGGTCACGACGTCGAGAGCGACGGGGG
TCGGGCCACCAGACGTCGATCCACTCGTCCGGAAGGAGAAGGCATTGGAGTGGGGACAACTCGAGCAGCTCGGCCACTTCAACTGGCCAACAGGAGTCGC
CTCCGACACGGTACGACTACTCGAGCAGCCCCACGGTCGAGCTGTACAACGAGGAGGCCAGGTATTTCGAAGAGGAGGCGGTGGAGTCGGGTCCGTGGAC
CGAGTGTCTGCCGAACGACAGTGGCAAGTGGACCGTCGTGTTTGATGAGGACCGACAGGAGTACGTGCGTATTCGCGTGCCCGGTGCAGACGTGGACTCG
GAATTGTCAACGTCTCGCGTGAAGCAGAAGCCTGCGGCCGTGTGCATCGACGAGTTGGATTGAGTTGGGAAAGTTGGTGGCTACAGGCAGTAGAGAAGTT
GAATTGGAGAGTCATATCCTATACATTTGCACCTAAAGCAGGTGCGGGTACATGCAACGCATTGCTGTTGACGCGCACGATGACCAACCAAATGGGTTGC
CGTTGACAGGTGATACGCCAGGTGACTTGTGTTCAGTATGGCGATCTGGCTTGTTCAGCTTCACAATGATTGGCGACCGTCGACTAACGGCGGATTTCGT
GCGTGCAAAACTGTCAGGATACAGCAAAGGACACAGCAAAGGACACTTGCTCGGATTGCGGTCTCGAGCGCCCGAGTCTCATACTGGCACAGTAATCCCT
TGTTCTGCTGCAAAAGGCTGCAGCTGATCCATGGTGCCCAAATCTCGAGTTCCTCCTTCGCGCAACTTGCCTTTGCCTGTTTCAACCCGACGACCACAGG
CGATGGCTTCAAAAGGAGGGGTCACGCGCTTCTGGCTACAAGTCCCGCCCGTTTGCGCTCATGGGTGGGCCACGACTTCCCTCCCGCCGCACCACCGGCG
CCAAAATCTTCTGCAAAAGTCAGCTCATTTCGGCTTTTGCATTCGCGACGACTCTTCCTCTGAGTGCAG