Description :
From Genome Similarity Track
Location :
Scaffold_265:44244- 49513
Transcript NameFunction/comments
Hyaar_Emoy2813359GTPase HflX

Sequence
5269 bases(100 bases per row)
CTTCCTCTGACTTAAGGAGCTGTGTAGCTCCGCAACACTTGGTAGCACTTTTAGTCAATCTACGCCTGAGTCTTTAGACTGATCCTCTGTGAGGATGGAA
AACCTCACTCTCCTCTCTGAGGCCCAAAAGGTCGCGCTTGATAAGCTGACCGCATCTTTGGGTCCAGAGTATGTAGAATTCCTTGTATCGCAAGGCCCGG
AAGTGCTGACTGCACGTGTTGAGGGCTTCTTGCATTATGAAGCGTCCCTTCTAGGGCAGGTCCAAGACCAAATGGCGTCGGCTATGCCTACACGCTATGT
GTCTGTTCCAGACGAAGAGGCTAGGCCTCGTCCACTTAGAGTGGAAGTTAAAAACTACTCAGGAAAGGAGGGTGAAAACTTCATCCTCTGGATCCGTGAG
ATTGAGATGGCCATAAGATCAGGCCTGATCAAGCTTGACCATCAACAGGTCTCGCTGGCTATCTCAAAGCTCGACGGAAGAGCTAGAGAATGGGCCTTGA
CGTGTAGCACGTCAGTCGACCTAGCTTTTCCCACATGGGAGTCGCTTAAGTCACAATTGGTACAGGTGTTTTCACCACCCAACCAGGCTTACCGCGTGCG
TTCACGCTTTTTATCAACCCGTCAGGGTAAGAATGAGTTAACGAACTATGTCCAAGAGTTGAGAACTCTCATGGCTGCTATCCAGTCCGACACTCTGCCT
GAATCAGTCCATGTGACTATATTCATGGAGGGTCTCCGTACTGGCGTTGCCGGAACCGAAGTCTTTCGGGTTCACCCCTCTACATTCGAAGAGGCTGTGA
AAATTGCTCTTAATGCTGAGCATAACTTCAAGTCGGCCAGAATTGGCTGGAATGGGTACAACCCTAGCTCTGCGAGAGCAAACTCCACGAGTACTCCGGC
CGTTAATAGGCCGGAGCCGATGGATCTCAGCTATGATGAAGATGAAGGTGAAGTTGAACTTCAAGCTGTTGAGCAGCAACGTGTTGTACGACGGTGGTAT
ACGTGCGGAAGCACTAAACACTTACGGCCTGGTTGCCCTTTGCGTAGACAGCGCCAGGCTACGAGCCAACACTCTATCCCGAGCCAGAAGTCTGGCATGG
CACGGGGACATGCCGACACCCAGTAGGCGCGGGGCTCCCTACTGGGGAAGAATTAGATTCTGTAACACCTTTAGGAGGTAAAGTTGAACAGGGCTTAGCC
CCAAAGAGTTCCGTACCTATTGGTATGGAGCGTGGATACAAGTCTGGCTTGTTGGTCGCTGAGGCGAAAGTTAAAGGCTTTGAAAAGCCTTGGTCGATTT
TAATCGATTCTGGGGCGTCTTGCAATTATACTCGACGTCGTTCCCTTGAGGGAAGTCAGCTTTATGCTGAAGCGCTTACAGCGCATGAGGGTGATTCCAT
CACGGTTCGTTTAGCGACTGGAAGTCGTGTCACTGTACCTAAAGTTCCTTTGAACTTAGGTATAAAGTTTTTGGACTTTGATAGCATTGAACGCTGTCTT
GTCCTTCATTTGGACTCGAGATATGATCTCATCCTAGGTATGGCTTGGCTTGAACGCCATGCGCCATGGATTGATTGGAGGTCAAAGACCTTTGGCGCTA
CGGTCAATGTTCCTAGTGAAGCTTTGGAGAGTCATGAACCCACCTTTGATAGGCAACAAAAGCACTATTGGCGCGAGCCTTTGACAGAAGATGTCAATGT
GCTGGATATTGGAATGTATGAGTTAACTAACTTCAATGTTGAAAACATGAATTCCGAGCGTATCTCTTTGAGTATTAGTGATACGGCACGTACTCCGTTG
AGTGTTACTCGTTGTGATAACGAGTCACTGCATGCTGAAAGTATGATTGGCCTAGGGCCGAGTTATCAAGGATGTGATTCCTTTGATGTGTGTGTGGTGG
CACGTGAAATGCACCGAGTGCGGTCGGCCGTGAAGGCACCACACTTAACGTCGGTAATGACATTGTTGGCGAAACGCCATTAAGTTCATGGCTAGGCCCG
TATAATATAAGTGGAGTGGCACTTTTAAATCCACTGGGTGAAGTGTTCGAGTTACGTAACACTTCACCGGATGTAGATCAAGACATCAGCTCTCGTATAG
AGCGTACTACTACTAGTAGTAACCTCGGGGACACTATTGTCCCGACCCCAGAGGGGTGTAAGGTCTCATCGAAGAGACGATCTGGACGCCAGGTGGAAAC
TGTTAAGCGCCAAGCGTCCGAGCAGCCACATAGTGACAATAGTGATACACTATATACACTTGTCAACGGAGTGACTGGCCAGGTTGAGGGCAATGTTAGC
CTGGAAACCCTTCCATCTTTGGATGCTCTTTGTGAGCTAGACGAAATGTCTGATGGCGAGTTTAGCCAGGCCTTGAAGGCAGGAGATTTATCCGCATTAG
TGGTCATTAGACCCGATGTCGAGTTGAACTCGTCCTCATTAATGGATGAGTCGGTCCTAGAGGACACAAAGGCGGCACCCAGTGCCCGGAGTGGATCTTC
GATCCTTAAAGATCCTTTGGATCCATTCTATCCTTTGGTAAAGGAATTTTAAGATGTGGTGTGTTACAACCCGCCATCTATCTTACCTCCCGATAGAGGT
GTACGTCATGAAACTGACCTAGTTTCAGGAACTAAATACTGCGTAACACGGCAGTGGCCTTTACTTAAGGAACAGTGTGACGTCATTGACGATTTCTTTC
GTGCTAAGCACGCGGCGGGAATGGTGCGGGAGAGTAAGTCTCCCCATTCCACACCTACTTTTTGTGTCAAAAATCCTAATGGTAAGTGGCGTATTGTGCA
AGCTTATAATAAGCTCAATGCTGCTACTATCCCGGCTCAGACACCAATCCCCAGAAAGGATGTTCTTCAGAACAATATGGTGGGATATATATTGTACAGT
GCGCTCGACTTAGTCGATGGTTATTACCAGCTGCTCATGCGAGCAAGCGATATTCCGCTAACAGCGGTTAGTACCCCAAGCGGTATGCTCTGGGAGTGGC
TCGTTATGCCACAAGGGCTGTCTAATTCCCCGGCTACTTTTAATCGTCTGGTGACGCAACTATTCAGACCTCATCGAGGCTATGCACAAACGTACTTGAT
GACATCTTTGTTCATAGTCGTGCAACGGACGGTCGAACTGATGTGGATGATCACATTGATCATTTACGAGCGGTGCTCGAGTGCATGCGCACGAATAAAT
TGTATGCAAATGCATCTAAGTGCATCTTTGATGCAGAAGAGATTCCCTTTCTGGGGTGCTTCATTGGGAAGCGAGGCCTTCGAGCGGACCCCGCTAAGAC
AAGGGCCATAGTCGATTGGCCGGTTCCAAAGAATCAAAAAGATCTACGTAAGTGGCTTTGCCTTGCCAATTACTTGCATAAGTATAGTGCGAGTTACGCA
GATATGGCTCGGCCATTATCCAGTCTCCTTAAGAAGGATGTGGATTGGTGTTGGGGTAACACCGAACATGATGCTTTTCAAGCAGTTAAGGAAAGTCTCC
TTCGTGCTCCAATACTGGCTTTGCCTGATCCTGATCGGCCTTTCAGTGTCGTCTGTGACGCATCTGACTTTGCCATAAGCAGTGCTCTGTTATCAACAGA
TGTCGATGGATGCGAACGCGTCAGTGCATTCGAATCTAGACAGCTCAAAGCTGTTGAAAGGAACTATCCAGTTCATGACAAAGAGCTACTTGCTATGAAG
TACGCTCTAGTCAAATTCAGAGTACATCTGCTTGGCTCAAAGCCATTTGTGATCTATACAGATCATGCATCATTGTGCACTGCGACACAGTCGCCGCATC
TCTCTCAGAGAATGGCTCGTTGGCTTTCATTCTTTTCCGAATATAACTTCGAAGTGAAGTATAAGCCAGGAAAGCAAAATGTTTTGGCTGATGCGCTATC
GCGCCGACCTGACTATGAGCTTGCTCACGTCACTACGCTGTCATCTTCAGTCACTGACTTAATCCGTGCAGCTTATACCAAGGATGAACAATGTGTAGCT
TTGCTACGTGCTCTTGACAGCGAGGAGTTTAAAGACTCGGACATAGAATTGTCGGTACGTTTACGTGCGAGGCTACATCGATATTCTATCGATAATGGCC
TGTTGTGCTATCGCACAGATATTGAGGATAACCCTCGTATCGCTGTCCCTCATGATGAGGAGTTAAAGTATCGAATCCTCTATGATGCACATGATACCGC
TTTAAGTGGTCATCTCGGTCGTGAGAAGACCTATAGCTCAGTGAGCCAGGCTTATTGGTGGCCCAAACTATACAAGCGGGTGATCACCTACGTGCGCACG
TGTGAAACGTGTCAACGCGTCAAACCCTCAGCACATGCGGCGGCGGCGCTGGCTAGTCGGCCTGTATCCTCTGGGTGTTGGGATTCCATGAGTATGGACT
TTGTGTTTGGCCTACCGAAAGATTCGGATGGCAACACTGGCATTGTGGTCTTTGTTGACCGATTGAGCAAGATGGCTCATCTAGCGGCAGTGCCGGACTC
GATTGATGGTGAAGGCATAGCTTTGCTGCCCATTGATCACATGTTTCGACAACATGGTTTTCCAGTGGCAATTGTCTCTGATAGAGATCCCCGCTTCACT
GGGAAGTTTTGGAAGTCCATCTTCAAGGTGCTCGGTACTCGTTTGGACATGTCCACAGCGGATCATCCGCAGACCGATGGTCAAACTGAGCGTGTTAATC
GCGTCATTAATGACATTTTGCACAGTGTTTGCGCTGATACGCCTAAGAGTTGGAGCTCCATGTTCCCTGTTGTTGAGTTTGCGTTGAACAAAGATGTTCA
TGCCTCTACAGGCTATACTCCGTTCTACGTAAACGGTCTCACCCACCCTCGCGTTCCGTTAGCGCTACCACTATGTGGTTCAGGGCTTGGTGGGGGAGAG
GTTGCCGATCGGCTTGCTGATATCAGCCCTGCTACTGTTCAAAAAACAGGTAGGCGAGTTTCTCGCAACGCGATTGAATGTCTTAAGACATGTGCGTGAC
GCAATAGCTGAAAGCTAAGACCAACAAAAACAAAAGCAGATGCTAAAAACAGAGGTTGTTTTGAACGTTATCAGGTCGGAGACCAAGTATTACTCAATGC
TAAAAACCTACCAACAAATGTAGTGTCCGCTGTCTTAGGAAAAAGTTGAGTCCACGCTTCATTGGACCATTTGCGGTCACTGCCAAGAAGGAACTTGCGT
ATACGCTAAACCTTCCGCGAAAATTGCGCACACACCCAGTGTTCTACGTAGTCTTACTTAAGCCATACC