Description :
From Genome Similarity Track
Location :
Scaffold_265:44238- 49521
Transcript NameFunction/comments
Hyaar_Emoy2813359GTPase HflX

Sequence
5283 bases(100 bases per row)
CTAAGTCTTCCTCTGACTTAAGGAGCTGTGTAGCTCCGCAACACTTGGTAGCACTTTTAGTCAATCTACGCCTGAGTCTTTAGACTGATCCTCTGTGAGG
ATGGAAAACCTCACTCTCCTCTCTGAGGCCCAAAAGGTCGCGCTTGATAAGCTGACCGCATCTTTGGGTCCAGAGTATGTAGAATTCCTTGTATCGCAAG
GCCCGGAAGTGCTGACTGCACGTGTTGAGGGCTTCTTGCATTATGAAGCGTCCCTTCTAGGGCAGGTCCAAGACCAAATGGCGTCGGCTATGCCTACACG
CTATGTGTCTGTTCCAGACGAAGAGGCTAGGCCTCGTCCACTTAGAGTGGAAGTTAAAAACTACTCAGGAAAGGAGGGTGAAAACTTCATCCTCTGGATC
CGTGAGATTGAGATGGCCATAAGATCAGGCCTGATCAAGCTTGACCATCAACAGGTCTCGCTGGCTATCTCAAAGCTCGACGGAAGAGCTAGAGAATGGG
CCTTGACGTGTAGCACGTCAGTCGACCTAGCTTTTCCCACATGGGAGTCGCTTAAGTCACAATTGGTACAGGTGTTTTCACCACCCAACCAGGCTTACCG
CGTGCGTTCACGCTTTTTATCAACCCGTCAGGGTAAGAATGAGTTAACGAACTATGTCCAAGAGTTGAGAACTCTCATGGCTGCTATCCAGTCCGACACT
CTGCCTGAATCAGTCCATGTGACTATATTCATGGAGGGTCTCCGTACTGGCGTTGCCGGAACCGAAGTCTTTCGGGTTCACCCCTCTACATTCGAAGAGG
CTGTGAAAATTGCTCTTAATGCTGAGCATAACTTCAAGTCGGCCAGAATTGGCTGGAATGGGTACAACCCTAGCTCTGCGAGAGCAAACTCCACGAGTAC
TCCGGCCGTTAATAGGCCGGAGCCGATGGATCTCAGCTATGATGAAGATGAAGGTGAAGTTGAACTTCAAGCTGTTGAGCAGCAACGTGTTGTACGACGG
TGGTATACGTGCGGAAGCACTAAACACTTACGGCCTGGTTGCCCTTTGCGTAGACAGCGCCAGGCTACGAGCCAACACTCTATCCCGAGCCAGAAGTCTG
GCATGGCACGGGGACATGCCGACACCCAGTAGGCGCGGGGCTCCCTACTGGGGAAGAATTAGATTCTGTAACACCTTTAGGAGGTAAAGTTGAACAGGGC
TTAGCCCCAAAGAGTTCCGTACCTATTGGTATGGAGCGTGGATACAAGTCTGGCTTGTTGGTCGCTGAGGCGAAAGTTAAAGGCTTTGAAAAGCCTTGGT
CGATTTTAATCGATTCTGGGGCGTCTTGCAATTATACTCGACGTCGTTCCCTTGAGGGAAGTCAGCTTTATGCTGAAGCGCTTACAGCGCATGAGGGTGA
TTCCATCACGGTTCGTTTAGCGACTGGAAGTCGTGTCACTGTACCTAAAGTTCCTTTGAACTTAGGTATAAAGTTTTTGGACTTTGATAGCATTGAACGC
TGTCTTGTCCTTCATTTGGACTCGAGATATGATCTCATCCTAGGTATGGCTTGGCTTGAACGCCATGCGCCATGGATTGATTGGAGGTCAAAGACCTTTG
GCGCTACGGTCAATGTTCCTAGTGAAGCTTTGGAGAGTCATGAACCCACCTTTGATAGGCAACAAAAGCACTATTGGCGCGAGCCTTTGACAGAAGATGT
CAATGTGCTGGATATTGGAATGTATGAGTTAACTAACTTCAATGTTGAAAACATGAATTCCGAGCGTATCTCTTTGAGTATTAGTGATACGGCACGTACT
CCGTTGAGTGTTACTCGTTGTGATAACGAGTCACTGCATGCTGAAAGTATGATTGGCCTAGGGCCGAGTTATCAAGGATGTGATTCCTTTGATGTGTGTG
TGGTGGCACGTGAAATGCACCGAGTGCGGTCGGCCGTGAAGGCACCACACTTAACGTCGGTAATGACATTGTTGGCGAAACGCCATTAAGTTCATGGCTA
GGCCCGTATAATATAAGTGGAGTGGCACTTTTAAATCCACTGGGTGAAGTGTTCGAGTTACGTAACACTTCACCGGATGTAGATCAAGACATCAGCTCTC
GTATAGAGCGTACTACTACTAGTAGTAACCTCGGGGACACTATTGTCCCGACCCCAGAGGGGTGTAAGGTCTCATCGAAGAGACGATCTGGACGCCAGGT
GGAAACTGTTAAGCGCCAAGCGTCCGAGCAGCCACATAGTGACAATAGTGATACACTATATACACTTGTCAACGGAGTGACTGGCCAGGTTGAGGGCAAT
GTTAGCCTGGAAACCCTTCCATCTTTGGATGCTCTTTGTGAGCTAGACGAAATGTCTGATGGCGAGTTTAGCCAGGCCTTGAAGGCAGGAGATTTATCCG
CATTAGTGGTCATTAGACCCGATGTCGAGTTGAACTCGTCCTCATTAATGGATGAGTCGGTCCTAGAGGACACAAAGGCGGCACCCAGTGCCCGGAGTGG
ATCTTCGATCCTTAAAGATCCTTTGGATCCATTCTATCCTTTGGTAAAGGAATTTTAAGATGTGGTGTGTTACAACCCGCCATCTATCTTACCTCCCGAT
AGAGGTGTACGTCATGAAACTGACCTAGTTTCAGGAACTAAATACTGCGTAACACGGCAGTGGCCTTTACTTAAGGAACAGTGTGACGTCATTGACGATT
TCTTTCGTGCTAAGCACGCGGCGGGAATGGTGCGGGAGAGTAAGTCTCCCCATTCCACACCTACTTTTTGTGTCAAAAATCCTAATGGTAAGTGGCGTAT
TGTGCAAGCTTATAATAAGCTCAATGCTGCTACTATCCCGGCTCAGACACCAATCCCCAGAAAGGATGTTCTTCAGAACAATATGGTGGGATATATATTG
TACAGTGCGCTCGACTTAGTCGATGGTTATTACCAGCTGCTCATGCGAGCAAGCGATATTCCGCTAACAGCGGTTAGTACCCCAAGCGGTATGCTCTGGG
AGTGGCTCGTTATGCCACAAGGGCTGTCTAATTCCCCGGCTACTTTTAATCGTCTGGTGACGCAACTATTCAGACCTCATCGAGGCTATGCACAAACGTA
CTTGATGACATCTTTGTTCATAGTCGTGCAACGGACGGTCGAACTGATGTGGATGATCACATTGATCATTTACGAGCGGTGCTCGAGTGCATGCGCACGA
ATAAATTGTATGCAAATGCATCTAAGTGCATCTTTGATGCAGAAGAGATTCCCTTTCTGGGGTGCTTCATTGGGAAGCGAGGCCTTCGAGCGGACCCCGC
TAAGACAAGGGCCATAGTCGATTGGCCGGTTCCAAAGAATCAAAAAGATCTACGTAAGTGGCTTTGCCTTGCCAATTACTTGCATAAGTATAGTGCGAGT
TACGCAGATATGGCTCGGCCATTATCCAGTCTCCTTAAGAAGGATGTGGATTGGTGTTGGGGTAACACCGAACATGATGCTTTTCAAGCAGTTAAGGAAA
GTCTCCTTCGTGCTCCAATACTGGCTTTGCCTGATCCTGATCGGCCTTTCAGTGTCGTCTGTGACGCATCTGACTTTGCCATAAGCAGTGCTCTGTTATC
AACAGATGTCGATGGATGCGAACGCGTCAGTGCATTCGAATCTAGACAGCTCAAAGCTGTTGAAAGGAACTATCCAGTTCATGACAAAGAGCTACTTGCT
ATGAAGTACGCTCTAGTCAAATTCAGAGTACATCTGCTTGGCTCAAAGCCATTTGTGATCTATACAGATCATGCATCATTGTGCACTGCGACACAGTCGC
CGCATCTCTCTCAGAGAATGGCTCGTTGGCTTTCATTCTTTTCCGAATATAACTTCGAAGTGAAGTATAAGCCAGGAAAGCAAAATGTTTTGGCTGATGC
GCTATCGCGCCGACCTGACTATGAGCTTGCTCACGTCACTACGCTGTCATCTTCAGTCACTGACTTAATCCGTGCAGCTTATACCAAGGATGAACAATGT
GTAGCTTTGCTACGTGCTCTTGACAGCGAGGAGTTTAAAGACTCGGACATAGAATTGTCGGTACGTTTACGTGCGAGGCTACATCGATATTCTATCGATA
ATGGCCTGTTGTGCTATCGCACAGATATTGAGGATAACCCTCGTATCGCTGTCCCTCATGATGAGGAGTTAAAGTATCGAATCCTCTATGATGCACATGA
TACCGCTTTAAGTGGTCATCTCGGTCGTGAGAAGACCTATAGCTCAGTGAGCCAGGCTTATTGGTGGCCCAAACTATACAAGCGGGTGATCACCTACGTG
CGCACGTGTGAAACGTGTCAACGCGTCAAACCCTCAGCACATGCGGCGGCGGCGCTGGCTAGTCGGCCTGTATCCTCTGGGTGTTGGGATTCCATGAGTA
TGGACTTTGTGTTTGGCCTACCGAAAGATTCGGATGGCAACACTGGCATTGTGGTCTTTGTTGACCGATTGAGCAAGATGGCTCATCTAGCGGCAGTGCC
GGACTCGATTGATGGTGAAGGCATAGCTTTGCTGCCCATTGATCACATGTTTCGACAACATGGTTTTCCAGTGGCAATTGTCTCTGATAGAGATCCCCGC
TTCACTGGGAAGTTTTGGAAGTCCATCTTCAAGGTGCTCGGTACTCGTTTGGACATGTCCACAGCGGATCATCCGCAGACCGATGGTCAAACTGAGCGTG
TTAATCGCGTCATTAATGACATTTTGCACAGTGTTTGCGCTGATACGCCTAAGAGTTGGAGCTCCATGTTCCCTGTTGTTGAGTTTGCGTTGAACAAAGA
TGTTCATGCCTCTACAGGCTATACTCCGTTCTACGTAAACGGTCTCACCCACCCTCGCGTTCCGTTAGCGCTACCACTATGTGGTTCAGGGCTTGGTGGG
GGAGAGGTTGCCGATCGGCTTGCTGATATCAGCCCTGCTACTGTTCAAAAAACAGGTAGGCGAGTTTCTCGCAACGCGATTGAATGTCTTAAGACATGTG
CGTGACGCAATAGCTGAAAGCTAAGACCAACAAAAACAAAAGCAGATGCTAAAAACAGAGGTTGTTTTGAACGTTATCAGGTCGGAGACCAAGTATTACT
CAATGCTAAAAACCTACCAACAAATGTAGTGTCCGCTGTCTTAGGAAAAAGTTGAGTCCACGCTTCATTGGACCATTTGCGGTCACTGCCAAGAAGGAAC
TTGCGTATACGCTAAACCTTCCGCGAAAATTGCGCACACACCCAGTGTTCTACGTAGTCTTACTTAAGCCATACCGGTATCCT