Description :
From Genome Similarity Track
Location :
contig_38:442336- 470601
Transcript NameFunction/comments
g8415.t1XP_009515415.1 hypothetical protein PHYSODRAFT_343735 [Phytophthora sojae
g8416.t1OWZ23553.1 U4/U6 small nuclear ribonucleoprotein Prp31 [Phytophthora megakarya
g8417.t1hypothetical protein
g8418.t1hypothetical protein
g8419.t1RAW41931.1 hypothetical protein PC110_g1882 [Phytophthora cactorum
g8420.t1XP_009515411.1 hypothetical protein PHYSODRAFT_293744 [Phytophthora sojae
g8421.t1KUF91590.1 Leucine-rich repeat-containing protein 45 [Phytophthora nicotianae
g8422.t1hypothetical protein
g8423.t1hypothetical protein
g8424.t1hypothetical protein
g8425.t1hypothetical protein

Sequence
28265 bases(100 bases per row)
GACAGGATAAGCACACCCTTGCCCTTCATACCAGCACGCGCCGTACGTCCAAGGCGGTGAATGTACTGGTCACGGTCAGTGAGACCCACCTGGAGCACTA
GCGACACATCCGGGTAATCTACGCCACGCGCCGACACGTCCGACGAGAACATCATGACCTTGTGGCCCTTACGGAAGGCCTCAGCCGTCTTCGTGCGCAC
CGCTTGACTCTTGCGTGAGTGAATCTCAAGCACACCCGGGAAGCCCGCGGCTTGGAAAAGCTGGGCCATGAACTGCGCCGAGCGAGCGGTAGGGAAGAAC
AACATCACCTTGTACGCCGGCAACTTCATGTGCGCAGCCAGCACGTGCTCCATCATGGGGACCAATTCCTTCATCGAGCATACAATGTACTCCTGCTCCG
TCTGCGCGTTCGTGTCAGCCTCGTTCTCGTCGATCGTGTCTACGAACGCGTAGTCCGAGCGCAGAGCCACACGCTTGAGCTCCTCTGTCGAAGCAGGCAG
TGTGGCGCTGAACAGCAGCGTCTGACGCTGCTTCGGCAGGTAGCCAATGATGCGCATGACATCCGGGCGGAAACCCATGTCCAGCAGTCGGTCAGCTTCG
TCCAGGATCAGCACACTGGCCTTGCCTAGTCGGTCAGCGATCCTGCCAGTGTTCTGCTTCAAGTGGTCAACAAGACGTCCAGGAGTAGCGACAAGGATGT
CAATAGGCGCGCTGCTCGTGAGCGTGCGTTCGTCCTTCTTGATGTTGGCACCACCCACGAAGCAGGCCACGTTCAGCTCGTGGAACTTGGTAAGGCGCTT
AGCCTCGGTCGCGATCTGCTGCGCCAGCTCGCGCGTGGGCGAGATGGCAAGCGTTGGGATCGTGCCCTGGCGACGTCCCTCCTGCACCATGTTCTCGATC
ACCGGCAGCAAGAAGGCCATGGTCTTGCCGTTGCCTGTCTTGGCCTTGGCCAACACGTCCTTGCCCTCGATGATGAGCGGGAACGTCTCGTTCTGCACGT
TCGTGAGGCGCTCGTACTTGAGGTCTTCGACGATGGCGCGCTTGGTCTGGGCCGAGATGTCCAGCGACGCGAACAGGACGTCCGACAGGTAGTCCAAGTT
CGTGGGCTTAGAGGCCTCCACCGGCGCAGCATCAATGGGAGCAGGAGCCTCCTGCGCCACCGGGGCAGCGGTCTCTTGGGTCTGCTCGGAGTTCTTACTG
CCGTTGTTGCGTCGGCCGCCGCGACGCGGGCGCTTCTTCTTGTGCTCGGCGTCGCTGTCCTTGCGGTCGCCGGCGGGCGCCTTGCGGCGCCAGTTGCCGT
TGTTGCTGTCGTTGTGGTCTTGGCCCGGCATCTTGAGTTGACTTGGGTGCGTGCGTGGCCGCGGGAGAAAACTGAAGAGTGAGTTAAACGGCCACAAACC
AACCGAAACGTGTCCTTTCGCGGGCAAGACAAGCCACTTGGCGTTTGTATGCTCATTGAAAACTACGATATGGCATACTGCGACAGTTTCTTTCCATTGA
TCTCCCGATCTTCCACTTCACAATATGCCACAACACAGTTACCTACTCATGAAAATCCAAACACAATTAATTTTAAATACTTGCAGACATGTCGACGCTG
GCCGACTCGTTCCTGGAGGACCTAGACGAGCTCAGTGGGGGCAGCAGCGACGAGGGGGAGACGCCCACGCCTGTAAACGCAGACGAAAAGGCCGAAGACG
GAAATGACGCCGACGAGCTGATGCCCGATGCGTCTCAATCGGCCAAGAGGAAGCGCCAAACGACCGAGGAAGAGCTGCCAGACGAGAAGACCCAGGACTT
CGCTCAGGCGCTGCGCTCAAGCGTGAAGCAGCGCGGCGTGGCGGCCGTCGCGACACTCAAGCGCTCACCCAAGTACCTGGCTCACGTGCAGGAGATTCAG
CAGTTCGTGGACGTGGACGACGCAACAGCAGCCAAGCCCCAGCAGCTCGAGGAAGGCAGCGCCGAGTACGACCTGGTGGTGACGTCCAACGACCTGATGG
TGCAGATCGACGACGAGATCGAGGCCGTGCACCGCTTCATTGCGGAGACGTACGCCGCCAAGTTCCCGGAGCTGGACTCGCTCGTACCGAACGCTCTGGA
CTACGCTCGCGTGGTCAAAGCTATTGGCAACGCGATGGACCTGACGCTCGTAGAGGAGCTGCCTAAACTGCTGCCCAGCTCCGCAGTCATTGGCATTTCC
GTCACTGGGTCGGGGACCAGTGGCAAACCGTTGGCCCCTGAGGACCTCAAGACGTGCATGGAGGCGTGTGATGAGCTGCTGTCGCTGGAGAAGGACAAGA
ACATGATCCTGCGCTTCGTCGAGAGCCGCATGAAGTACTTGGCGCCGAATGTGTCGCAGCTTGTGGGCACTCGCATTGCAGCGCAGCTCATTGGACTTGC
TGGTGGTGTCGCGCAGCTTGCGAGGATCCCGTCGTGCAACTTGCAGGTGTTGGGGCAAGAGAAGAAGGTGTTGAGTGGGTTTTCTTCCGCTGCTGCATTG
AAACATACGGGCGTCCTGTTCTTCAGTGACCTGGTGCAGAGTATGCCCCCCTACTTGCGCATGAAGGCGTGTCGAGCTGTCGCTGGAAAGCTAGCGTTGA
TGGCGCGCGTGGACAGCCAGCCGCACCAAAATGACACGGAAGGTCTCGTGGGTGCACGCTTTCGGACTGAGCTAGTTGGTAAAATGGAGAAATGGCAGGA
ACCTCAGAAAGCCAAGACGAAGAAGGCACTGCCGATCCCAGACGAAAAACCGCGACGTAAGCGCGGTGGCAAGCGCTACCGCAAGATCAAGGAGCGGCTG
CAGATGACGGATGTACGCCGTGAAATGAATCGGCAGTCTTTCGCGACAGCTGACGAAGAGTATGGTGACAACGCCATGGGAATCACATCCGGCCGCCTTG
GCCAGGAAGGATCGGGCAATTTGCGAATTATGCGCAAGGAACAGAAGCAGTCGAGCAAAAAGCTGCGTGCCGCGAACTTTGCTGCGTCGTCCGCTAGCAA
GCCACCGCTTTCTGGATTGGCATCGAGTCTTGCCTTCACACCCGTGCAGGGTATTGAGCTGATGAATCCTGAAGCTGCAAAGGCTCGTGTTGCGGAAGCC
AACAAAAAATACTTTTCAGCTGCTAGTGGGTTTGTGAGCGTCGTCAAGAAGCCGTAGACTGCCGAGAACACTGTGATCAGCCTGAAAAGATGTTGTTGTC
TTGCTCAAGTCAAGAAGATAATGATGCTCAAGGCACGAACAAGGGGAAACGAGCGGCTGAGCAATAAGAAGTTTTGGGTTTGACACGTTCGTGGTCGGTG
CTTTTAGTGTCTGTCTTGCCCTGACATGGTACTCTACGACGCTGGTTGATATCTCTCAGGTCTATCTACACTGGCCTGTCGGTCAGCTCAGTGCCCTAAG
ATCTCGAACGTCGTGATCGATTGAGCTGGGAGACCCGCACTGAGTCTGGCACTCTGGCCAAATACGATGTCGGTGCTGGAGGTTTTGTATACGGCTCCCG
ATGTTGTGTTCAGCTCCGTTGTCCAGATATTAATGGGGCCCTCCACGCACGATCGAGCCGACAGATCAAACGTAATGGTCTCTACGTCACCCAAGTTCGT
AGCCACGATGACCATCACTTGGGTAGCTTTGCCGTAAGCAACGACGAAGTTCGGGTATTTATCCAGGGCGTACGACGAGGATCCAGGAATGAGCGTATTG
AGGTCGTCAAACTTGAGGATGGCCATGCCAGCACGAATATGACGCGAGTAGGGAACCATCACGTAGTGCTTCGGATTGGCCGTGCTGATTCACTGGTCAC
CTGGGTTCGACTGAATAAGCGCCACTACTCCGCTGCCAAGAGCTTGCCTGTAGACGAAGGCCGATGCACCCATCTCATAAATGTCTCGAGCGATGGTCTC
CGCTATGGTGAGACCAGAGGTCGAATACGTCGGCTCTGCGCTTCGATGCCAAGCCAAGCATTGCTCGCTGCTTTGCATCCGCGTCCCAGTTCCAACTCTT
TGGGTCAGCACGGACCCGACATCAGTCTAACCAGAACGTCTCGATTGCATTGAACGCCGGCATGTTCTCTGACGTCTTTATGGCGATCTCCGTTCCACTA
TCATCGATGACGTTATTACCGGAGCCGCCGATGTTGTAGCGTGCGATGTTGAAATCGAGTGCTGGAATGTCCTCTGCGACGCCATTAATGGACACCGACG
ACACGTTGGTGAAAAACATGTCGGCGATGTCTTCGCGGTCTCCGAAGACGTTGGCCCACCAGGAGAGCGAGGTTCCCCATCCTTCCCAGGACTCGAGCAT
TGTCGTCGTCGTTACTGAAATCGTGTGACTTGAGAAGGTTGGGCGGTTAAGAGTGCCCAGGCCAACGTGGAGCTTGCAATCGATGCAGTCGTGAACATGT
TTCTTGGATGCAGTACCAGTATGCTCTCGCACGAAGCAAAATGGTGAATGAAGAGCGAGTTCGGTACATACCTGTATAAGCAGAGAATGAACCTGTTCAA
TCCGTGTACAGTTCGGTCGCTACCGCAATCTGCGCACACAGGAAGGGATAACGTGGGTTGCAGCGTGTAAGATGCGTGGATTACACGTTATCGAGTATAA
TAACGCTGCCTCGTTTTCTCGTCCAGACAGTAAAAGTCGGCTGCAGTCTTGCCACGCGATCAGCTGGGGATCTGTGGATGCTGGGCAGGATCTGCTTCGG
GAACTTTCAACTACGGCGAAACTTGTATTAAATACATGTTGTTCATGAGCCCACGACATCGGCATTCACGTGTGTCGATGCAAACTCGCTTGGTTTCCAC
ATGTATCAAGTCGCAGACTCTGAGATTAAGACAGCATACGTTGGAACAATCCCTTAGCATTTCATTTTTACGTTCATTTGGTTCCATCAGGTGCCTCCAT
GTTGCTCAAAGGAAGTACTCCTCGTACTTCTGCTCGTAAATGATGCAAAATCGTCGGTCGGGGGTGCGCCTAACGCGATGCAACGTGCCTGGGATGCGGC
CTTCCGTGGCTCGATGCAGAGCATGACCACAGAAAAGCACAATCTCCTTACCCGGAACGCACACCTTCTCGGCCTTAAGCCACTGTTTGGAGTGAGGATC
GTACACATCCAGTCCCTCCACGCTCGGTACAGGCTCCACAACATACAGACTCGGATCGATATGCTCGAACACATTTTCCGTCTCGGACTGGCCGCTTCCT
TCAATGTTCGGGTAGTGCAATCCGTAGCAAACCGAAAAGTCTTTGTCCGATCGCGCACCACTCGGCTCAATATCATAGCCGACAGTCAAGCTCAATGCAC
GGTCGCAGATGCGCTGCATGCGGCGCTGCAGACCCAGCCAGTGGTCCTTAAACTCTGGTGACGGCCACACCAGCCTCGACATGTCCCCGCAAGCCACTCG
GAAGCAGTCACGCACACTCGTGTGCTCATATCCGCAGTACCAAAACGGTTTGCCATGCTCGTTGCGGTACACGTGTTTGCTTGTGCATCCGTTCTTCCAC
TCGTCATCGTCGCTCGTGAAGAAGGTCTCAAAGTCCTGAAGCACTCGGTCGTGGATACGCTCCAGCGTCTCACCGAGCTCCGTGAGCACCACGAACGAGT
GGCGCTCCATCATCTCCAGAAAACGAGCGCGGTTCTTCCAGTTGAGGTCACTCAGCCGCAGACGCGGCACTTGCACCGCATCGCCGGGAGTTTGTTCAAC
TCGTTTTTCGACGGTCTCACATGGCCTCTGGACGTCGACGACGACGTCGGTAATTTCGCCGCTTGCATTGAGGCAGTAGTAACTGGCTGCCAGACTGTAA
CCAGTCGGCATGGAGAAGCCTGCAGCGGTCATGTCGGTGTTGGCGCGGCGCGAGGATTAATGCACACGAATGGCTACGACTCCTTGGCCGTGTCTTTGCG
TCAGAGAACCGGGGCCCCACGTTTAGTGTCCAATCAACAAAAGTTCAAGTAGATGACCATCACTCTGGTTGTGCTGCTGACAGCACGCTACGGGCCCGGT
TGCCTAGCACCGTGGAAGTCGTTGGAGTGTACAAATCTACTGATTGGTTTATGGTATAAATTAGCGCGGTGCTCGACACGAAGATATGCATGTCGACATG
GCGAAGGGGGTACGCAGTGGAGGGACGAGCACCAGCAAAAGGTTTACCGGTACACGCTAGGCACGGCGCCTAGACGTCAAGTATCTTCGAGACGTGGTTG
CCTTTGTATTGGCCCCGTGCAACTGGTTGTCCTCCTTGTAGTCGAACAGACGCGAGCGCACCTGATCCAGACGACCCTGCCACTCAGGCGTGCGCGGTCT
CCGCGTCATGTTGCCAACGTGCTTGGTCTTGTCAGCGGCCAGGTTGCGGTTGCGCTCCTCAAGCTGACGACGGCGTTCGAGGTTCCTGGCTTTTGTGGCC
GCAAAGCGCGGCGAGCTGTCGTAGTCCATGTACCGAGGAACAGACGTCGAGATCGAGCGGCTTTTCGGAGACGTAACCACGGGTGGCGCACCCCGCGCCG
ATTCCGAGAAATGGCGCGTCGACTTGACGGGCGGCGCAATGGTTGCTGAGAGCGACGAGCGACGAGACCTCGCGGGCGTTGGTGCTACTGGAGGCGGGTT
CTTAGCGGCATAGAGGGAAGAGCGGCGCGACTTTGGGGCCGAAGAGACTTTGTCCTTGGTAGTGGTGGACGGCGATTTGCCCGTGAGCGAAGCACGTCGA
TATGAGTTAGGCGGGACAAGCTTCGAGGTCTTTGTCGATTGCAGGTTCTCAGGGAGCGACGAGCCTCTCGAGCGGTAGACGGTGGGCTTGACATTCTTGG
AGGCTTCAGCACTGGTCTCGCCTGACGCCTGCAGTAGATCAGGCAGGAAGATGTCGAGCGAGCTAAGAAGCGAGTCCAGGGAGCCCGTGGATGCAGTGGA
GTAGGACGACGGGCTGGGAGGGACAGCCGAGTAGCAAGTGGATTTGATCGTAGTCGTTGAGTCGGCATCGCTTTCGTCTTCGTAAGAGTTAAAAGTCATG
GGGTCATACTCATTGTCGGACTCCAGCGTGTTGACTGTGAGGCTCCTGTAGACCGCAGGCTTTGTCGGGGTCTCTGGCACAGCAACTGGGGTCTCCCCCT
CAGCAGGTTCCGTGACGTCCTCTGTCTTCTGCAATTGTGCAGGCTCCGACTGAGTGCGGGTGCGTTGTGTGTTCATGCGCACGATGATTTCCTTCACCGG
CGAATTTGGCTGCAACGGCAGATCCATGCGTTTAGATCCGCCCACGGACCAGGAGCGCGGAGCTGCAGCATTGGCCTGCGCCATGAGCTCGAACCGGGCG
ATGAGAGTCTGCACACTCGAGGTGCTGTCCATTTTAATTGCCTTTGTCTCGGTGGACGACTAAGATAGCGGCGAGAAGCGTTTCCGCGATGGGAATCTCG
TTCGTGTGAGCTCTGCGGGTCCGAAGCGGAACTGGCAGCGGTCGACACTAGCTGGCAGCGTTTTCGTGCTCGGCTTTCGGGGCGGGGCTGGCTCTTCCAG
TCCTCTTTCTGGCGCTCGCTGAGCTCGTAACTCGTCGCACCCCAGTTGCCCGGCCAGTTCCGAACTGACCTGGCACAAAACGCTTGGTGCGGATGGCTTC
AACCACGGGGCCCGCGCCGTTTCGACTTTCGCCAATCGTGGAGCTTATAGCGCATTAATGGCCAGTAGTGAGCCGCGATATTTAGGCGGGATAAAGATCG
CAGGTGATGTGTCCAGCGACATATGCTGCGACAAAAATTCGATTTCCGGCCCATACCGCTGCTAGCAACTCTGACATTTGATACTGTCGTATTTAGCAAA
CCATATAGACAAGCTATACAACAACGATTCCAAACATGATAACCTACTCTTCTGACATACTATGCTTTCCCGGAGGCCTAGTTTAAAACGGCCAATCAAA
TGAGGCGCGTCACATGCTCGCCTGGATCTGCTTCAACTTGAGACCAAGTGTCAATTCACTGTCAATGAGGCCATGTATCACAGTTACCTGAGGCGAAACG
CTAGAGCCGCTGGCGTCGATGGCCATGGGCGCAGCTGCATTGGCGCTCGAGGACTCGTGCGGGTCGATTGCTCCGGTGCCGCCGCGCCCTTTGCCGGCAA
ACAGGCTAGGCGTCGGACCTCAGCGCGTCGGAAGACCGTTTCTTGCGGCGTTCTCGCTCCTTTGCGATTTGCTCCTGCACGAAACGGCCAAAGGATTCGG
CCAGGTCGTCGATGCGCTTCTCGTGCTCGTGGTTCTGCGCCGACAGCTCGCGCTCCAGCCGCAGCACGTGGCCTTCGAGCACCGCGATCGCCCCCGCCTT
CTCCTTCAAGATGGTGGCGCTCTCCACCGCCGCGATCTTTGCGCTGGCATTCAGAGCCTGCAAAAAAACACAGCAACGCATCAGTATGCTGGGCAGGAGG
CTCTGACAGACAGCTAGCGAACGTACATGGATCCGTTCGTCGAAGGTTGCGTGCATCTGCACGAGTCTGGCGTCCTGCTCTTCTAGCCTCCGGACCTGCT
GCTGCAACTTCTCCTCGCACCGAGCTCTCTCGCTCGTCACTGCGGCTAGCTGCGCCTGCTTCTCCTGCAACGCCCTGGATTGCGTCTCCGTCGCGGCCTC
GAACTCGCTCTGCTTTTCATCTCGGGCTTGCTGCAGCGAGACGTTGTCTTGTCGGAGCTGGATGATGGTCTCAAGGTGTTTTTCCACTTCTCGCTCGAGG
TGCTGCCGCGCCTTCTTCACCTCGGCGACTTGGGCCTCCACCGATCCAACAGAGCGTTGGATGCGCTCCTGCAGCTCCGCCTCCCATTGCTGCTTCAGCT
CTCCGACTGTCTTTTCGTGGCCAATTTGCGACTGCAAAAGCTTGGCCTGCAGAGCCTCACACTTCTCTTTGAGTTCGTGCACACTGCGTTCACTTGCTTC
TAGCTGAGTGGAGGTGTAACTAAGCTGCGTCTGCACAGAGCCAACGATCATGTCGTGCTGCCGCTGTGCTGCGCTCATACTGCCTTCGTGACCCGACACG
AGCTTGGCTTCTTTGCGGCCATACTCTTGTTGGGCATCTTGGAGCTGCTTCTGCAGCTTACCGATTTCTTCTGCTTGCGTTCTGCACAGCATTTTAGTAA
CTTAGCACGACCATTTCCATTACTAAAAGCAATGAGTCGCCTACCTTAGTGTGAGTGTTGAGCGATGTACTTCGTTGTCGAGAGCATACTTGACCTCTTC
CAGCTGCGAGATCTGCTTGTCTTTCTGCTCCGTCTCCTTGCTTCGCAACGTCTCCATGTGCCCCATTTTCTCGCGCACAACGCCATTTTCGCGCTCGAGA
GCAGTGCGTGCGGCCCGGTACTCTTCGAACTCTAGCTTTCTTCGGTTCTCGAGTTCATCGAGCTGCATTCGCAGTTCATGGACGTCGCGCTTTGCATCGA
TCTCACGCTGTTGATACCGATCCCGTTCTTCTTTGGTCATTTCAGCGTCTTTGCGGACCTGCTGCAGCTGCGCCTCGAGCTCTTCCGTCGTCTCCACCTG
AATGGCAACAAAGCTCATCATTAGCCCTCGCCATCTAATAGTAACAAATACTTCGTAGTATGTGCACCATATCTTACCATTTTCTGCAGTTCTCGCTTGC
CTAGATTCCTCTCTAGCTCGAGCTCTTCTTTCTCCGCCAGAACTTGTAGTAGCAGTTGGTCATCCCGAGCAGCTTTATGGATCGAATTGTTGGATTCGAC
ATCTTCATCGGGTTGGCACGACGCATCTACGGCCAAAGGTGTCTGTCTTCCCGAGAGCGCTCGATTCCTTGTCAACAACTCCTCAATTTCGTCCACGTGC
TTTAAGCTGCTATTGTTCCCCATGAGCTCCAGTGTCACGAGCGAGTGGTTGCTCTGCAATGCCTCACGAAATGAGAGCACGCCTGGGTTTCCGACCTCAT
TCCAACGCAAGTCCAGTTGACGTAGTGAGCGGTTAACTCTCAAAGCTTTTGCCAGCGCCTTGGCACCCTCGGGCCCAATGTTGTTGTTGCGCAAGTCGAG
CGTTAGCAACCGTTTATCGACCTCCAGCGCACCGGCGAGAGCTTCCACCCCCTGATCCAGCAAGCCAACATTATTCCACTCCAGACTGATGGCCACCACA
TTGTGCGACGAACGAAGCAGCGCCGCAAGCGCTCGGGCAGCCCCAGCTTCGAAGCAATTCCCTCTCAGATCCAATCGAGTCGGAACGCTCGCAAGCCGAG
CCTTCTCGACAATCTCCGTGAACTTGTCGTCTCCCAAGTACAAGTTGCTGTAGTCGAGCACTGCGTCAACGGGCTGTTTGAGGTGCACAAGGGCTACAGC
CTCCGAATCCTCGACGAGACACTCGCCCTTCGCTGGGATCGTCATGCTTGTGACAAGAGTCGTTTCGTTCAAAGCACCCGCGATCTTTTAGATCCGGAGC
CTGTTCAACATGTACATGAAGCTGCTCGTTACTGAGGACACGCTTGTCTCTGTAGTGCGTATGGCCGACACTGCTCTAGTCAGAAGCTGGAGTCAGCGTG
GTAAAAACTTCACCATGCAGCCGGTTGCTGCAAAACGACTGATCAAACAACGGACGGCTTAACATATTGCACAGCTCGAACATGTACTGATATCCCCACG
TGGTTGGCAGCTAAATATGTGTGGAGCTTACCCAGACGCTTCCAACTCAGTCGATTTGGGTTGCAGTCGATTGGTCCTGGTCATCAAAATTGTAGCAACG
CCAGAAGTTAAGTCCCTCTAGTACTAGCCGAGCGTTGTCGATGCCTGAAAACTACTAGGACAGGCGAAAGCCCTTCAAACATGGGCGCCACGAATGAATT
TGAAGTTGCAACGGGCACTTGGTTTGCAACACGCACGCCACTTATACTACACGTGGATGAAAGCACACTGGCATTCACATCGAGACTCGCTGGTGAAGAT
CATGGGATGTCTCGCCACCTGGGGCTCTGGCGTGCGCTTACAGCACACTGCTGTTTCGACTGTCAACAGCATTTGCCAGGGCAACTGTACAGGTGGGGCT
TGGAGGATCTCCCAGATGTACATGTCATTGCCAGCCGAATAATACTGCTTGGTTGTCGGGTATTGCTCTGCCGTTCGTTACTACACGATGCAAGAATCCA
CCTGATAATTATAGGAGTCCAAAGCTGGCAGCCTCACTCTCGAAAACGCCGCGTAAGTGGTGAAGTCTACTTTCTAGTTCATAATGGCCCCCGTCACCAA
TGCTCCTCTGACGCTGCATTCGCGGATCCAAGAAAGTTTTGATGGTCTCCAGTGTGTGGACCTGGTGGAGTGTGCTGCCTCCGGGCGCCTATTTGTCGAC
AAGCACACCCTCCTGACCTCCTCCACCAGTGAAGGTCGTAATGCTAGTGCTGCGGCATTGAACGAATTGGACCTCCACCTTTCGGTTCGAGACGCCGAGA
ACGTGGTCAAGCTGGAACGGCATTTGCTGCAAGGAGAAAGACTCCACCTACTGCATGAACACTGCGCCCGCGGCGACCTGCTTGAAATCATGCAGCAAGA
ACTTCGCCTTCAACGGCGGGCGTGCCACCTCACAGCTCTTCGATGATGACCTGCACTGACGCTGGGAGACGCCGTGTTTTCACTGCCGTGCTTCGAGGTG
TGCAGGCTCTCCACTGCGCTGGAATCGCTCACTTGGACTTGTCACCGGAAAACGTCTTCGTCACAGACTCAAGCGTCGCGAAAGTCGGGGATCTGGGGCA
CGCCCAGCGATTCAAGCACGAGCGACCAAGCGTACAGGTCGTACAAGCTGCCAAGGAAGCGTACGCTGCACCGGAGCTGCTAGCTCGCAAAGACGTGGAA
GATGCACGTCAAGCTGATGCCTGGGCTCTAGGCGTCATCCTGTGGACAATGTGCACCAAGCGTGCTTTCGTGCGTCGCGCGTGTACTGACAGCGACCAGT
TATTCTGCCGCATGACTGAACGAGGCACTGCGTTTGCTCTCCAGGAGACTGGGCTGCTCTCCCAGATGCCGGCCGCGATGGTTGACCTGTTGGCTGGTCT
CCTCGATGTGAACCCCAAATCAAGACTTACGGTGAGCGCAGCTCTGCAGCATCCGTGGGTGAAGCAGGAATCTGCAACAAGCAAGCAGCAGTCTCGACGC
AAGTCCATCGGCAATATGTTCAAGAAGAAGGGTGAGGAGCTGATGAAGAAGCACCAGCGCCCGACCGAGAAAAAGTCGCGAGGTCGCACCGCAAGTACTG
AGATCGCACTCGAGTCTACGCGTGTGGCCTTGACGTCCCGAAATCTAGCTTAGAAGCCGACTAGCATCCACTCGTGTCTAGCACTAGAACACGCTTATAA
GCGCTCTTTACGAGCGCAGAGCCCAACTATAAACGGGATAACATGAAACGAACGACTGCCATCGACGTTGCCCCTCTAAGCCGTCGCGTCCGCTTGATCA
ACTCCAGTCGCAGAGGAGCCCTCGAAGCTGTGCTATCTTTCGACGCAGCTTGGTAGCATCGAGACGGGTGCAGAGCTTCGATGCGTCGACACTTCCTCTT
CGCCGAGGATGAAAAGGAACGTAGTGTTGGGGACGGCAAGGCCAACCTGCTACGACTATGGCACAATCGACGAAATGCGATGCTGGAAGGTGACGAGTCC
GCCGACGGGGGTGAAGCGAACAACGCGTTAGTTGGTCGTGAATTGACACTGCTTTGGGATTTAGCCAAGCCCCTGAATTCACGTACTTTGCAGCGTGACG
GATACGTTGAGTTTTTCGCTCGAGCAGGAAAGGCACTGGTACTTCCGTTGTCAACCGATGCGATTGCGATCCTCGCGGCTCGACGCGACTGGGAGTACGA
TTTAGAAGGTGTCGGCAGCGTCAATGAGTCTACCAAAGCAGCTTCAAGTCTGGACGCTGAGGTCATGTCAGCCGTGCAATTCCGCGAGGCAGTCATGCAG
CTCGCGGAGATTATCTTACCGGTTGAGAGTGCACCCAGCGTTTTCGCGGCCTTCTTTCGGGATCTACGCAATTCTGTAGCGGAACTCGCTGCCTCTCCTT
CAGGCAGAGAACCGGAGCAAGATGAGACCAATTCCACTGAGCCGGTTGACCGCTTCACGCTTCGACCATTGAATCGCATCCCGAAAATTGCGAATGACGC
GTTCCTGCAAAAGCTACCGCCTTCGAGCGAGGCCTTACGAAGTATCCGAGGGCTTCAATCTCCTGACCAGCGTGAGATGTCACTCAAGCAGCTTCTTCTG
TGCTACAACCCACGAAAGTTTTCACTCACCCGTGCGTTTTCCAAAAAGAAGGGCAGTGACACCAAAGTAGCAGAGGAAGCCAAGGCAGATACCGTTGATA
CTCCTCAGCCCGATGTCGAAGACGAAATGGCAGTGGCAAAACGTTTGCATCTGGAGCTCATGGGCTCTATTGGTTCGGGGGCAACCCCCGTCCGAGGAAG
AAAACTCCACCGTGAAACTGCAGCACATCGGAATCCCGAGGATGCTCTTATTGCAGCTCTGACCGAGTTTCCTGCACTAAGAATTGCAGTGGTGGGGCCA
CCTGGGTGTGGCAAGACTCGACTTGCCCGTGTGCTAGCTCAACGACTTGGACTAAGGTATTTGTCACTTGATGGGGTTATTCAGCGCGCGGTTGACCACA
AGCTCCGCATACGTCGACGTCGACCTGCCGTCATTATCCCTGTAGAGGGAGAGGACTCAGCTGTGGAGACACCTCTGGAGATGGAGACGGTGGAGGCAGA
CGAGGAAATCGATACTGACAACGCTGGAGAGGACGAATCCATAGACCAGGTTTTTCGAGATGAAGATCTCGATGCTCTTTGTGCTGGAGGTGTGGTTACT
CGGAGCAAGGCACTGGATCTGTTTCGACTGGAAGCCACTCGTTCTTTACTCGGTACGTTCTGCAGCTTTATCGATGATGAAATCAAAGCGAAACTCACTA
TTTATTCCCTTCTTGTAGCTGGCGTCGGTGTGATTATGGACGATGTTTACCCGTGCGAACTTTCAATTTCAGATAACCCAGGGCACAGCATAGCAGTAGA
CTACTTGATAGCCCTCACAGCACTTCCCACCGAGATAGAGCACCAATTGCAAGGCTCACAACTAGCACCAGCAGCGGGCCGTCTGTACTCAGTACGAGAA
CTTGCCACTTTGAAAGCAACACACGCTGAGGGGTTGGTTGCTGAAGGCTTTGCCGATTGTCTACAACCACCGAAGAAACCGGAGGTTGATGCCGAAGAAG
TGCAGGAGCCCAATGGTAGTACTGCAAACGGTGATGCCGGAGCTAGTAGCGAAGACCAAGAAGTCGACGAATCTCCTTCTCCAGAGGAAAATGATGAGGA
AGGAGACGGTGGACAAGTTCTATCAGAAGAACCTGTACTACCACCGGAACCAACTCCTGCCGAACGCAACGAGATCGAACCTCCCGGAGAACGCACGTTG
CCGTTTGGTTCAATAGCGATGGCAAAATTCACCAAGGGATACCACGAATACGTGACGCGAATGCAGCGAGAACTTTTAACACGTCGAGTTGCTGACTCAA
CGGAAAAGCGATCGGATTGTCATTTGGTGGTGGCTCTGTCAACTCAGTCTCTCAACGTGATTCGAGACCACTGCATCCAGACGATCACGGGTGTAAGTAG
AGATGCCAATAGTTGTGCGCTTGTTTTTGGTTTCTTGACATTCGGCGTGCTTGTATTTTGGTGCTGTACAGACGCCTCTAGGCCTCTCGCGCTTTAGTAC
GTCGCGTGAAGCTTGTCAAGTATCTCTGCCGGAGAATTTAAATGGTTCCAGCCGCGCTGAAAAAGTGAGGTGGCTACTCTACGGAGATTGGGCCGCGCTT
CTTGAAGCCGAAGCAAGCTCCACCACCGAGTCGTTCGCAAGACTACCAAGACGTGATGCAAAACGCCGATTGCTCTCGAAGTGGCGAGAGTTTTGTCCTG
TAGTCTCGACTTCTGTTGGTGCTCTGACATTAGGCGATCCTGAGTTTGCAGCATGCTACTCCGGTCGGGTCTACCTGCTGGCTTCACAAGAAGCACGGCG
TGCCTTCTGCGCATATCCATTGCAATTCTTGCTTCGAGAAATTCCAATTCCGTCCAAGTGTCGGAACTTCTGGCTCGTAACCACAGGTGCAGGGGATGCC
TTCACGCCCTCATACCTAGAGGCGCTCGAGGCTGGGCTCCATGTGCAGACCGTGAGTACTTCAAAGCTGCTCAAGACTTCACCCAGCATAGCGATGGAAA
TGCGTCTCATGAGCGGACAAATTGTATCCCCCGTGGAAGCTGCAGCGATAGCCTCCGATGCTGCCAAAACGTTGCTGGCGAAACAAAACGCGTCTTCTGG
GTGGATGCTCATGGACTTACCGCTTACGCGTGATGTCGCTGCCGCACTGCTCGAACACGGATGTGTCCCCGATGCAATATTGCTGCTGGACAGAGAGGTC
GCCGCTGTTCAAGAAGATGGCGAAGGAAGTAGTGCCGCCAACATGAGTGCTTTATCTGCACTGCGACGTCAACAGTTCCAGACTGAAAAGGCTGGCGCTG
AGGACGTTTCACAAGGAATTGGAGGTGTTACTCGGGTGATAACGTGTCCATTGTTCCGTCAGCCGAGTGACACATTGGCAGCCATCGAGCGAGAGCTTAA
TCCAATCGCACCACGTTTGGACAGGATCGAAGACGGACATGCTCCAGAGCTAGTTGATGAGTACGACCCAACTGTCATATTTGCCTCACCACTACCGGAA
AATGACGAAGTTAACGAAGGAAAATCAACATCAACTTCAGAGGAAGGAGATGAAGTCGATGTCACCGACCCTGAAGCGGAAGCTCAAGCCAAAGCAGCAA
GAAGTAGAGCTCTGCAGCTTCAGGGAGAGTGTGGACATTTTTGCCCCGTGACTTGGCACACCCGTGGTTTGTTGATACCTGGACTGCCAACCAACGTTTG
CTTGTTCCGCCAGAAGTTCTATGCCTTCGCTGGAGAACAGGAGCGACTTGCTTTCGAGCGAAATCCAGCAACCTTCATCCCAAACGGGCCTCGGTCAACC
ACTAATTTTGTACCATGCGTATTGGTGCTTGGTGTTCGAGGATCCGGACGCGGCCGGGTCACTGCGGCACTTGCTAAGTCTCAATCGGATTCCCTCGTGG
AATATCTCAATCTGGACTTGACCGTTGTTGCAAATAGAGCAGAACGAAGACGATTGCTAGAGGAGCTCAAGCCGGAAGAAGCACGCATGACTTCAGAGGA
AATGTTTGTCGAATCCCTTCAGCTCGAGCTTAAACGTCAAGAACCAACACCCAAGAAAGCTGTAGCGCGGATTATCGCTGGACTGGGGTCAGAACCGTCA
CGCATCCCAACCACAGCGATGCTGGAGATGTGTTTCAAGCATGGACTCGTTCCAGCACTTGTGGTTCCGCTGACAGTGTCAGAGGATGACGTTGTGAACA
CCTTGTTAGATCGATGGGCTGCCAGCTTACCGACACCTCGCCGAAAGCTAGCTCTCATGCGAAAGAAAGAGGCTGGCGCTGAAGGTGAGGACGATACTGT
CCCCGAAGACGAAGCTGAGGAAGAAGAACCACCGATCGACCTGGAAGAAGCACGGGAAGAAGAGAGTACTCGACTGCACGAACAATTTACGGAGGACCAG
AAGGCTCTGGATGAGGCTATCGCTGGACTCCGAGCGCGAGGTGTCAGGACCTGCAACCCGATAGACGCTTCCGGCGCTTCAAGACAGATAATCAAAAACG
TAAGACGCCTCCTGAACGACTTTATGGCAGGACGGGAGACTCTTCTTGAGCACTGCGAAGTGATCGACATGCAGCGGGAGGCACAATGCAGCGGCTACTA
GCATCAGGAGAACTTCTTGTTGGCAAACATGGAGCTTCCTGTCCCGTGACAGGACGTACTGATTCCTTATCGGTTGCCTCTGTGAAAGCTGTAGTGCATC
GAAACCAGCTTTACTTTCCACGGTCACGCGAGGCACGTCGTGCTTTCGTGGCTTGTCCGTCACGCTACTTGGATAAGCCTAGTCTTCCACCAATGCATCA
ATTGACATGTTGTGTGGCAGGAGCTCCATTTTCAGGCAAGACGCGTGTCTCCCAGGAACTTGCAAACGCACTTGGACTGGTCTACGTATCTCCTCAAAAC
GCAATCGAATGGGTGATGCAGTGTCAGGGTGGATCGGCACTGCGGCATCGGCTGCAGGAGATCACAAACTTGCAGCATGACCCGCTTAATGATGCAAGTG
TCACGCATGAGGTTATATGTGCTCGTCTTCGCTCTTCAGAGTGCCAGACACGTGGTTGGGTTCTTGACGGGTATCTATTGCAGCGCCATAAGCTGCAACG
CAGTCTTCCACATCCGGATTCGACAGAGGCTTCATCACAATGTATTCAACCGGACATGCTCTTCGTTTTAGAGTGCAGCTTCCAGAGTGTTTGGAAGAAT
CACCAGACTCACGTTGACAGGAACGAGCTTCGAGTGGCATTTACACAATGGCATCAACACCGTCTAGAGCTGCTAGGCGTTTGGACGCGAAGCTATGGTT
GTTTCCACGTTCGGCAACTCGACAGCTCCAGCAACTCGCTCTGGAACGTAGCTGCACAAGCACAAATATTTCTCGAAGAGCAACAGCAGTTGGCATCACA
CCACACGAGGGCGATGGCATCCGGTCGAGCTGCCCGCTCATTAGGTGTGGTGCGCACGGATGAAGAACTTCAGGGGCGCCAACACAATATTTTTCAGACG
TTCTGCCCTGTTGAGCTGCAGGCAGGGAAGTTTTACAACTCTCGCCAATCAAGCCGTGACCTATGCGTCGACTTCCGAGGCTGCAGTTTCTGGCTTGGAA
GCGAGCAAAACCTTGAGCAGTTCGTTGACAACCCTGAAGGCTTCGTTGGGTATTTACCTGAACAAACTCCACTTGAACGGGGAGAAGAGTCGTGGCCAAC
GCAAGAAGACGCAGAAAGCGAGGCACAAACTCTTGTCGCAAAGGCACCAGTGAACGCTTCGCTGGTGAGTCTGCTCACCGTGCCGGACTGTGACTTCCCT
GAGATGAAAGGCTATTGCCCCGTTACATTCGCGCTGGGCTCGGGCGACAAAGATTGGGCTTCACTCCGTCACGGCAGTGTTTTCTTCCGCGCATCGTACC
GCTCAAAAGTTTACTTCTTCGTCTCGGAGGAAGCACGGCGTAAATTCTGCGCTGAGCCCTCTCGATACGCGTCACAAAGTCTGCCGGTCAAGTTACCACC
CCAGGTGGCACTAGCCAAAAGCTACCCAGGTCAATTGGAGCAGAAACTTGGTGCTGCACTCAACGAAGTACTGCTAGCGCTGGGTTGTGAACGTCCTAAG
TTCCCGCAGATGCCGATGCGTGCTTCAGCATGCGTATATCTCGCCCTCTCACTCAAAGCCCTGCAACGCAAGTACCAACTGAAAGTAAAGCCTGACCCAC
GCTCAGCTCGAGACGAAGACGAACCGGACGAAGAGCAGAAACAACGACAGGAACGGAGAGAAGAGCAGGCCGAGCGGGATGCGACCGCGCGCCGTGACGC
CTTCGTGCGTGACTGCCGACTTGGGGAACAACTAAAAGTTGCTTCCACTCCGACACACACATCTTGTGGCTCTGGTGCAAAGGTTGCACGCAGCATGCGT
GCTGCACACGACTCACTGGCAGGCAATGAAACGGAGAGCTACATCTCACCAGCACCTGCCAACGAAGAAGTTGATCAGCTTCGCCACCGTTTCGATGCTA
TTGTCTCCGGGAGCAGCAGTGCCGATAAAACGCTATCAACAGACCCTCGCTCAGCACGAACACATGCCAGAGCTGCATTCCTCGAGTACATCAAACCTTC
TACAGCAATTTAGCAAGATCAGAAAGATGACGAACTACACTTCAGCGTATGCATCAAACAAACCTGTTGAATTTGAACAAGTACATGCATATCTACCTTG
TCCTTCGTCTCAGCGCAGCAGAGGTGTCGACTCGGTCACGTCAATTGCCACATGATCCTGTTGCAGGCCCCAGTTACCACCGAAAGGTGGCTTCCAAAGG
TTAAGCAGAAGTGAGAATAGGATCACGGGCACAGACGAAAGCAGCTCCGACAGACCAGCGAGGGCCGGGGGGATCCAAATTCCAAGGGGCCCATACAGCG
CACCGCAGGCCACAGGCATCATGAGCAGATTGTACATGAACCCCCAAGCGAAATTGTGCTTAATGCGTCTGTTGGTTGCGCACGAAAGCGCTCGGGCATT
CAGTAAATCGCGCAGATCGTCCTTGACGAGCACGACGTCGGCAGCATCGAGGGCAACATCCGTTCCGGCTCCAAGCGCCACACCGACATCAGCTGTGGCT
AAAGCTGGTGCGTCGTTCACACCGTCGCCCACGAAAGCTACGCGCAGGCCAAGACTCTGGAGCAAGCGAACCTTGTCCACCTTTTGATGAGGCAGGGTTT
CAGCTAGCACAGAGCCTTCGGGCACGCCTAGCGCCGTCGCCACGCTCATCGCTGTTCCACGCTGGTCGCCTGTTACAATCCATGGCTGAATGCCCTCGCG
CTTTAGCTGCTCGATAACACGTTTGGCTTCCGGGCGTGGAGTATCTCGCAGTGCGATAGCAGATAGCAACTTGCCATTAACAGCCAAGAAAACTACAATG
CACCCTTGTGATTGGAAACGATGATTCGCCTCGATGAACTCGGCATGGACCTGCAGAGAGCCTGAGCCACCGTAACTCTGCTGCTTCAGCCACGTGAGTG
AACCGAGGTGTACCTCAGCACCATTCACAGTGCAGTGCACACCACATCCCGGGATGGCCTCAAACGCTTGTGCTTCGTCGATCTGAGATGCTTGAAGCCG
AGTCTGAGCATGGGCAACAAGTGCTTTCCCGATGGAGTGCTCACTGCCGCTCTCTGCTGCAGCCACAAAGCGCCAGAGCTGGTTTCCATCAAAATCATCG
TGTGGAGTATAGAATACACCAGCAACCCCAAGGCGTGCTGTAGTGAGTGTCCCCGTCTTATCAAAGACGACCGCATCAACCTCTTCCAGCGCTTCAAGTG
CGCGACCACCCTTAAAGAGTACACCGACCTGCGAGCCTTTTGTTGTTGCCACCATCACTGCAGTTGGGACTGCGAGACTGATGGCACAAGGGCAACTAAT
GACTAGCACCGTGATCGCGAAGCGCAGCGCAAACGGAAAAGGAGACCAGCCTTGCGTATCCACGTGTCCATGCTTAGCGAGCGAATACCAAAGCATGAAC
ATACATCCGGCCAGAATGATGATGAACGTGGTGAAGTATGCAGCCACAGCGTCCGCGATACTTTGGCGCACACCACGCGAAGCCTGAGCCTCCCCTACAA
GACGCACCATTCGCGCCAGCATAGATTCGTGAATGGTATGCGTCACACGCATGGTCAGGACACCTTGCAAGTTTATGGATCCACCAATTACAGTCGCGCC
GGGTTCCTTGGGCACCTTGCGAGCTTCACCCGTTACCATCGACTCATCCACAGAACTGGCACCTCCCACAACCACACCGTCCGTAGGAACTCGCGTACCG
GGAAGCACTTTCAGCAAGTCGCCATGCTCCACAAGCACCACTTCAATGTACAACTCCTTCTGGTCTTCGCCCTCAAGCAGAATTGCAGTTTTTGCCTGCA
TGCGCAGCAACGCATCAACACTGTTTGAAGCACGCGCCTTCACCAGCGTCTCGATGTATCGACCAACAAGAATGAGAGTAATCAGGAGCACCGTGACTTG
AAAAAAAGTCTCCGTCTTCACTGGTGTTTGCTCTTGTGGAGGCAATGAGGGCTCTTGCACCAAAGGATCCACCTCTACAACATTAGATGCTTGATACTTT
GCGATCGCTTCTGTCGCAACTGTAAAAACAGAAAACGCGTAGGCAGTGCAGGCGCTCAGCGAGATGAGGACGTCCATAGTAACGCGTCCGCCGTAGCGCA
GCGCAAGGAAAGCACTTTCGTGAATAGGGAATGCCACAAGGAACAACGCTGGGGTCGCGCACGCCAACTCCACAGCGTCTCTGATGCTCAAAAGATTCGC
GGTGCCCCAGACTGCTGCATCTGCTAGATTAGTGTCGGAGGAAAAGAACGCTGGTAGCACAAACTCGACGAAGATCACCGGCAATGACAGCAGACAGCTC
CAGAACAACAGACGCGTAAAGCGCCTCACTTCTTCCTCTCCTGCGCGGACCGATGGCGCCCGCGGGCTTGAGGCTTGAACGGTGAATCCAAGCTCGTGCG
AGAGGTGCCGCACTATTTTACGAGCACCCGTGATATCCGGGTTGTACTCAACCAGCAACGCCTTACTTGATGGTCCCGACGAAGCTGGTGGCTCACTAAC
ATCTTCAGCCGAAGCGACACCAGCGACCTCAAGAACCAGTGTTTTGGCTCGTGGCACGATTTCAGACTGCCCAAGGTGTAACACGATTCCCACGACGTCG
TCACCAGAGAGCACACTCGGTTCAAATCCCAAGGTGGCTACGGTCTCTTCGATAGCCTTCGCCGTCACTAGCTGCGGATCAAATTGAAAGACGCCCCGAC
TCGTAAGCAGGCTCACATTCACGTCCACAACACCACGCTGTCCGGCCATGAACTTCTCGATACGCGTGCAACAGCCGCTGCATGTCATGCCACTGATGTT
GAGGCGGAGGCTCTCCAAGGACTCGGTCGTGTTACTCTTCCTACCCGAGATTGACCGGGTCTTCTCGAGAGTAGCCCCACAATCGTTGCGGAACTGCACC
AAGCGTTTCAAGAAGCTGGGAGATCGCTCCGGAAGTGACAGGCCCTTCGCATTCGACGAGCAGCAACCATCGGATCGTGTCTTAGACGCATCGGATGAGC
AGCAACCAGACGTCTTCGGCTCTTTCGTAGAAGCACAAGAGCCGTTGGCTTTGCCCTCCGTCTCGCCATTTGCAACCTTCGACGAACAGCAACCAGAGTC
ACTTGGGGTCTTTGACGGCTTCGACGAGCAGCAGCCAGACGCCTTTGTCTTCTCCGTAGTAGTACAACAATCATCAGACTCGGTCGCAATCTCGGCAGTC
TTGTTCGACGAGCAGCAACTGGAATCGTCAGTGGCCTTCTCCTTGTTTGACGAACGACAGCTCGACTTCTTCGGCTCTTCCGAAGCGCAGCAATCGTCGC
GTTCAGTCAATACTTGCGGTGCCTTGGACGAACAGCAACCAGCACCACTGGACTCGCCAGCAGCGTCCGACGGGAAGCATCCAGCCTTTTTCTCCACCCC
CGAAGAGTCAGCCTCTGCAATCTTCGACGAGCAGCAGCTCGGAGGTTTCATTGTCTGCGCGTCCACAGCCACCTCGCCTTCTCCCCCACAGCAACCGTCA
GCACAACCCGTTCCGCTCTCCGTCTCCTTTTTCTTGCTGCAGCACGAAGTCTCGCACGTCTTGTCTGGCGACTCCTGGGTTGTGTCGCTGGCCTCCTCAC
CGCTGGAGGAACAGGACGCTGACGTCTCTCCGCCGTCGCTCTTGTCGCAGCAGCCTTCAGTGTCCACGGGGCCCGCTACCGCGAGCGCTCGACAGCCGTT
GCGTTTGCCCATTGGTACTACTTGTCCAGCGTGCAGCGCGTTGAAGTCTGCGAGTTTGGAATCGACTTTTCAAACATAACGCAAAAGTTAACTTGCAGCA
AGCGCAACTTGAAATTAATGCAGCACAACTTAAACGTGCAGCAACGTAAGCAGCGCAACTTTATTACGAATCATTGTGTAATCGAACCGCAAGACCGGTT
AGCGGGTAATTGTAACCGCTGAACCGTGCTGACCTGGTACATTGTACCATATACATGTACGCCACACCAACTTGTGGTTGGCTGTGGTTTGCTCTGCGCC
AAGTCGTCTGCACCCGGCACCGCTCAGTTCTTTTCAGACAGGTAAGACACGCAAGTGTGTGGGTTGGACGCCTCAACGCCTCCTGACCTAAGTGTTGTGC
TTGTTTCCTCAGGTATATTCATCACCATGCCCGCTACCAAGACGCAGAACGTGGTGCTCGCCCGCGGCATCAACGCCATCTCGGCCAACAGCCTCTCGAA
GAAGAACGGCCGTGGCAAGGTCGTCAAGAAGGGCGGCGACAAGAAGGTCGTGGCCAAGAAGGCTACCACCACCAAGAAGTGGTACCCTGCCGACTACATC
CCGAAGCCGCTCCAGTCGGCCAAGACCAAGCGCAACAGCGTCAAGACTGCCAAGCTGCGCAAGTCCATCACCCCTGGCTCGGTCCTGATCCTGCTGTCGG
GCCGTTTCCGTGGCAAGCGCGTGGTCTTCCTCAAGCAGCTGGCTTCGGGCCTGCTGCTCGTGACGGGTGAGTTGCAAGTCTCTCTTTTCGGCAGAAATGG
AGTGCACAAAAGTAGCGGCATTCCGATGATGCAAACTTGACACTTCGAGAGGCACTCTGCCGTCCCCTTCCTACGTTCGCTTATACCCTCAAGCTTCGTA
CTTCGGCGCCTCATCCCGATAGCTTCCTTGTATGAGGTCTGGCTATTGGTGCTTTGGCTCGGGGTATGCGGAGCAACGCTGAGGGTCTAGGTGGATGAAG
AAGGGGTGTCTTTTTGCCAAAGATCCATCAGATTATGAGACCTGAGGAATGCCCGCTCTAGATCTCCTGCCTTGTGCGAGTTGATGTTGCTTTGGACGCA
ATTGCTGACATCAGATTGGGATTATTGATGTATTTCAGGCCCCTACAAGGTCAACGGTGTTCCCCTTCGTCGCGTGAACCAGTCGTACGTGATCGCCACG
TCGACCAAGGTCAACATTGAGGGTCTGGAGCTCCCTGCCATCGACGACGCCTACTTCGCCAAGGAGAAGGCTGCCAAGAAGACCAAGGAGGAGCAGTTCT
TCGCCCAGTCGAGCGCCGTAAGTGCTTGTTTTCACTCTGTTGCTATCCCCTGCCGTTCCTTTGGTCGGTTTTTCGAGACCACTACAAACAGTTCGTCCAC
ATCCAGCAAGGAAGTTGTTCTGCAGTTGGAGAAAGAGATTGACGAACCCTTTGGGATCTCTCTCTATCTCTGGTTTCAGTGCTCTTTCTTGTGTGGCGAA
TTGGGTAGGAGGCGTGGATGTCTTAGACGTCCATAGCTTCTTATCACATCATATGAGCGCTTGGGATCGCTTGCTTCGGCACATAAGCTCCCTATAAGAC
ACTGACCATGTTGGTGTTATTTCTCTCAGGCCCCCGTCATCTCGGAGCAGCGCAAGAAGGACCAGAAGGCCATCGACTCGGCTTTGATCAAGAAGCTCGA
CGCCGAGCCGTTCCTGAAGGCTTACCTGAACGCCAAGTTCTCGCTGACTAAGAACGACCGCGCCCACGCCCTCAAGTTCTAAGTGCGCTCTTGCTATCCT
GTGTAGCAGTGTGATGTGCGATGATTGAGATAAGAACAGCAACCAATATACCTGATGAACTTATCACCAAACATAAGTGTTTGTGTTGCATTTACCCTAG
AATCTCATCGAGTAGATCTTGGAGTATTGTACTCGTCATTGAAGGTTGGACCATAACTTATTAACATGCCACACAAATGGCAATAGCTCTTCGAGTTTTT
ATCCGATCAGATTAAGACGGCCACAACACTGTTCCTTAGTGCGTTGTACGTGCATTACAACTTTTACTTCGCTAGCAACATGTCTGGGTCAAACACCAAG
GCGCGAGAGCTGCCCCCATGTCCGAAGGGCTTTGCCGTACGGTGTTACGAGTTCATGACCATATCGAAGGAAGGAGGGCTCTTTAGGGGGAGGCGGACCC
GAGACCTTGTAGCTGCGTGTATGAAGATTGCTCGTGGCACCGCTACGACCGTAATAGACGAATACAGAGCCGACAACATTACCAAGTTCGAGGTCGGTGC
ACCATATTCGCGACGCCAGCACCTTATCAGGTGTATATCGTTAACCTGTGACATATGATACTTTCATCTCAAACCAAGCAAGCGTGGCATGAAGTGAGGA
CAAACTACCTCTGTAAATCGATGTTGGCTTAAATGATTTGAGCCCCTGGTTAAAATATCTATGGACGTTTTTTTACTACATTTGCACTTTCGCCTGTAAA
TCCATGTGTATTGCCCCCTCCTCCAATCAGAAGTGCTCCTCAAGAGCAACCCGTTTCCCGCAACTCTGAAGCCTCAGGAGTGCGTTTGTAAAGCGACCCG
TAGCGCAGTAACGGCTGCGATTCAGCCGATTTTGACCTCATTTTTGAAATCTAGACCCAACTTTGCACCCTATATCTAAATGTCGCTATAGGTTTTAGGG
CTGTGAATCTTCATAACCGATGGCTACATTTTGGTCCAACGACTTGTGACGAGTACAATAGGGTGTTCTCGCTTTTGCCTTCTTGTAATTCGTCGTCGTC
GCTGTTTTCTTCCGACGAGCATTTCCTTGTCGAATAAAGACCGGTGCTCTCACTGTTGCCTTCATTTACAAGCGTGTTGTAGCTAGAGCTCTTTTTCACC
CTGAGCGAACCACCGCTGGTCTGAATGGAACCAGTGCATTTTGCATCTGCTATCTCGCCACGAGCACTGACAAGCGAAGAGCCCCATTCTTGGTGCCGTG
CGTGTGCTTGGTATCGCTCTTTGGCTGTCCACTCTCGTCGCGATGACATGGCACCGCCACCAGCCCAATGACTAGCAGGCTCCACAGCAGATACCGGAAT
TTCCTCCGACTTTTTCGAGCACACACTTGTCCTTCCAGCATAGCTAGAGTAGCCTCCTATAGTTTTGTGGTCGCTCCGTAGCGGCAACACGGGCACTTCT
TCCTCGTGCAGCACTAAAGTAGGCACCGCAAGCGTTGGCCGTGCCAATGGCTGGTCGAAAAAGCGGTGTTGAAGGGCTTGCGCCGCTGTGAGACGTCGAC
TCGGGTCAAATTGCAGTAGGTCTTGGACAAGTTGAACCGCTGTGGATGGTGTGCCGGGCGGTAGAAATCGAGTCCAGGACACAGGAGAGCACTTGGGGAA
ACGCATCTGCATATGAGAAGACATCGCTGCACCTTCAGGCCACGTCTCCTTGGTCGGTGTTCCTAAAACCTTGCAGATGCGGTAGAACTGGTCAGCCTCT
GACGTCCCTGGGAAGAGCGGCGTACAAACCAGCAGCTCGACCATGATGCATCCGCAGGCCCACATATCAACGGGGCTGTTGTACGTTGTTGAGCGCAGTA
AGAGCTCTGGCGCGCGGTACCATCGCGTAGCCACGTAGTCTGTAAACGGCGGTCGCGATCGAATTTCGCGTGCTTGGCCCAAGTCAGCGATCTTGAGTGT
ATCATTGTGACACAACAGGTTCTCAGGCTTGATGTCGCGATGGAAGAATCCGTGCTTGTGCATGTATGCTAGGCCACTGAAGAGCTGGTACATCATCGAA
CGGATCTGTGCCTCTGAGAACCATGGATGCGGGGGCACCGAAGATCGAGATGAACTGGTAGCATCAGAATTTAAGCTTGGATCGCCTCCAGCACCACTTG
AGCTGGAGCTTCCGAGAGTTTTGAAGTTGCGCATGACCCGAAAAAGTGACGTCTGCATGTACTCGAACACGAAGTAGAGCTCCTCCTTGTCTCGAATGAC
CTCTTTTAGAAGCACGATGTTTTCATGGCGAAGCACGCGCAGCGACTTCAATTCGCGTAGCTGGAGACACTCCTCCCACGTGGGGAACAACGCCTTGATC
TTCTTTACAGCGACTATTTCATGGGTCTTGACGCTACGCGCACGCGACACTTCCCCGAAAGCGCCGTCACCAACTCGGTCCAGCATTTCATAGCGGTTCA
TCTTGGACCTGCTCCTCAACCCCAGCAATGTGAATAGTAAGGCACCCTCTGCACCTATAAACAAACACAAACCAGTAACGATAATTGCTAGAAAGGTCAA
AATCCTTTCGTGTTGCTGACGCGGCTTACACTGGTTCTATGATGATTTGGTGAGCTTGCTGTAGCTTTCGATCATCCAGCGGAGTGTGCGTGCTACCGTA
TCAATGTCGACTTTGTGGAGCGCACTGTGTAAACAAGACAAATCATGGTTAGATTTCCGTTGAAGAAGTAGAGAAGTATGAAGGCGGGCGCAGTTATACC
TGACAGGGAGTACAGCTAGATCGGTGGTCTGGCGCAGCTTGTTGAAGTTTTCTTCCGCGCCTGCATGATGCCAGAACAACGTCAGAGTGAGGGTGCTAAG
CACTCACAGTAAATGTTCCTCCCGTACCTTGCTCATCCATCTTGTTGGCAACTATCAGGGACGGACGCGACGAGATTCCTGGAGCATACAGCTCCAGCTC
TCTTTGAAGATGAGTGAAGTCCTCGAGGGGATCACGTCCCTCCGAGCCCGCCGTGTCAAGCACATACATTAAAATCTGTAAAAACACCGCACACACACCA
TGGTTAGCTCATCGCCCAGGTAGAGGAGACAGATCAATGATACACACACACCTTTGTGCGCTCGATGTGGCGCAAGAAATCGTGACCAAGACCAACATTG
CGGTGTGCACCGTCAATAAGTCCAGGGATGTCAGCCACACTCAAGCGGAACGTGTCTGGGAACTCCACAATTCCCACGTATGGGTGAAGCGTCGTAAAAG
GATAAGGTGCAATCTCAGGCGTCGCACGGCTGAGAACGCTCAACAGCGTCGACTTGCCCGCATTCGGGTAGCCTACAAGACCCACATCAGCGATGGTCTT
GAGTTCCAGCTCGTAGTATTGCGAGGTACCCGGGTGACCCGTCGTCTTGTTCTCCGGCATGTGCTTGCGCAGCCGTCCGAATTTGGTCGTCTTGCCTGCC
AGGATGCGGTTACCCAGTCCAGGCTTTCCGCCCTTCGCAGCAAGGAACGTCGCTCCAGGCTCGTCTAGATCACACACCACTTCCATCTGGTCCACAATCT
CGTACTCGCCATTCTCCAGTTCGCGCTCGTAGCGCTCCACGCGCTTGACGAGTGTACCACACGGCACCTTGACGTGGCAATGCTTGCCTCTCCTTCCAGC
AGAATCATTTGCTGGACGCCAGCCACGCAAGAGTCAGTACCCTGAAAAAGTATTTGCAGCACACAAATGAATCCCATGCACGTACCCATGCCGTTGGTGC
CGGCGCCTCCCCTAAAGTGGTGCGTGGCGTTCGCCAAGTTCTGCATCTTGTCGGAGGCTTCGATCACGACGTCTCCTCCAGCACCGCCGTGTCCGCCATT
TGGTCGCTTGCGCATGGCCGACTCGGCGAAGAAACTGGCGCAGCCATTGCCTCCGTGGCCGCCCGTGGCCTTGACGCGGATGCGGTCCACGAAGCGGCGC
TTGGAGTGCTGCGCGCGTCGCACGCGCACCTTCTGCTTGACGTGCTCCTCGACCTTGCGACGCCC