Description :
From Genome Similarity Track
Location :
contig_38:442292- 470557
Transcript NameFunction/comments
g8809.t1XP_009515415.1 hypothetical protein PHYSODRAFT_343735 [Phytophthora sojae
g8810.t1OWZ23553.1 U4/U6 small nuclear ribonucleoprotein Prp31 [Phytophthora megakarya
g8811.t1hypothetical protein
g8812.t1hypothetical protein
g8813.t1RAW41931.1 hypothetical protein PC110_g1882 [Phytophthora cactorum
g8814.t1XP_009515411.1 hypothetical protein PHYSODRAFT_293744 [Phytophthora sojae
g8815.t1KUF91590.1 Leucine-rich repeat-containing protein 45 [Phytophthora nicotianae
g8816.t1hypothetical protein
g8817.t1hypothetical protein
g8818.t1hypothetical protein
g8819.t1hypothetical protein

Sequence
28265 bases(100 bases per row)
TCGGACAGGATAAGCACACCCTTGCCCTTCATACCAGCACGCGCCGTACGTCCAAGGCGGTGAATGTACTGGTCACGGTCAGTGAGACCCACCTGGAGCA
CTAGCGACACATCCGGGTAATCTACGCCACGCGCCGACACGTCCGACGAGAACATCATGACCTTGTGGCCCTTACGGAAGGCCTCAGCCGTCTTCGTGCG
CACCGCTTGACTCTTGCGTGAGTGAATCTCAAGCACACCCGGGAAGCCCGCGGCTTGGAAAAGCTGGGCCATGAACTGCGCCGAGCGAGCGGTAGGGAAG
AACAACATCACCTTGTACGCCGGCAACTTCATGTGCGCAGCCAGCACGTGCTCCATCATGGGGACCAATTCCTTCATCGAGCACACAATGTACTCCTGCT
CCGTCTGCGCGTTCGTGTCAGCCTCGTTCTCGTCGATCGTGTCTACGAACGCGTAGTCCGAGCGCAGAGCCACACGCTTGAGCTCCTCTGTCGAAGCAGG
CAGTGTGGCGCTGAACAGCAGCGTCTGACGCTGCTTCGGCAGGTAGCCAATGATGCGCATGACATCCGGGCGGAAACCCATGTCCAGCAGTCGGTCAGCT
TCGTCCAGGATCAGCACACTGGCCTTGCCTAGTCGGTCAGCGATCCTGCCAGTGTTCTGCTTCAAGTGGTCAACAAGACGTCCAGGAGTAGCGACAAGGA
TGTCAATAGGCGCGCTGCTCGTGAGCGTGCGTTCGTCCTTCTTGATGTTGGCACCACCCACGAAGCAGGCCACGTTCAGCTCGTGGAACTTGGTGAGGCG
CTTAGCCTCGGTCGCGATCTGCTGCGCCAGCTCGCGCGTGGGCGAGATGGCAAGCGTTGGGATCGTGCCCTGGCGACGTCCCTCCTGCACCATGTTCTCG
ATCACCGGCAGCAAGAAGGCCATGGTCTTGCCGTTGCCTGTCTTGGCCTTGGCCAACACGTCCTTGCCCTCGATGATGAGCGGGAACGTCTCGTTCTGCA
CGTTCGTGAGGCGCTCGTACTTGAGGTCTTCGACGATGGCGCGCTTGGTCTGGGCCGAGATGTCCAGCGACGCGAACAGGACGTCCGACAGGTAGTCCAA
GTTCGTGGGCTTAGAGGCCTCCACCGGCGCAGCATCAATGGGAGCAGGAGCCTCCTGCGCCACCGGGGCAGCGGTCTCTTGGGTCTGCTCGGAGTTCTTA
CTGCCGTTGTTGCGTCGGCCGCCGCGACGCGGGCGCTTCTTCTTGTGCTCGGCGTCGCTGTCCTTGCGGTCGCCGGCGGGCGCCTTGCGGCGCCAGTTGC
CGTTGTTGCTGTCGTTGTGGTCTTGGCCCGGCATCTTGAGTTGACTTGGGTGCGTGCGTGGCCGCGGGAGAAAACTGAAGAGTGAGTTAAACGGCCACAA
ACCAACCGAAACGTGTCCTTTCGCGGGCAAGACAAGCCACTTGGCGTTTGTATGCTCATTGAAAACTACGATATGGCATACTGCGACAGTTTCTTTCCAT
TGATCTCCCGATCTTCCACTTCACAATATGCCACAACACAGTTACCTACTCATGAAAATCCAAACACAATTAATTTTAAATACTTGCAGACATGTCGACG
CTGGCCGACTCGTTCCTGGAGGACCTAGACGAGCTCAGTGGGGGCAGCAGCGACGAGGGGGAGACGCCCACGCCTGTAAACGCAGACGAAAAGGCCGAAG
ACGGAAATGACGCCGACGAGCTGATGCCCGATGCGTCTCAATCGGCCAAGAGGAAGCGCCAAACGACCGAGGAAGAGCTGCCAGACGAGAAGACCCAGGA
CTTCGCTCAGGCGCTGCGCTCAAGCGTGAAGCAGCGCGGCGTGGCGGCCGTCGCGACACTCAAGCGCTCACCCAAGTACCTGGCTCACGTGCAGGAGATT
CAGCAGTTCGTGGACGTGGACGACGCAACAGCAGCCAAGCCCCAGCAGCTCGAGGAAGGCAGCGCCGAGTACGACCTGGTGGTGACGTCCAACGACTTGA
TGGTGCAGATCGACGACGAGATCGAGGCCGTGCACCGCTTCATTGCGGAGACGTACGCCGCCAAGTTCCCGGAGCTGGACTCGCTCGTACCGAACGCTCT
GGACTACGCTCGCGTGGTCAAAGCTATTGGCAACGCGATGGACCTGACGCTCGTAGAGGAGCTGCCTAAACTGCTGCCCAGCTCCGCAGTCATTGGCATT
TCCGTCACTGGGTCGGGGACCAGTGGCAAACCGTTGGCCCCTGAGGACCTCAAGACGTGCATGGAGGCGTGTGATGAGCTGCTGTCGCTGGAGAAGGACA
AGAACATGATCCTGCGCTTCGTCGAGAGCCGCATGAAGTACTTGGCGCCGAATGTGTCGCAGCTTGTGGGCACTCGCATTGCAGCGCAGCTCATTGGACT
TGCTGGTGGTGTCGCGCAGCTTGCGAGGATCCCGTCGTGCAACTTGCAGGTGTTGGGGCAAGAGAAGAAGGTGTTGAGTGGGTTTTCTTCCGCTGCTGCA
TTGAAACATACGGGCGTCCTGTTCTTCAGTGACCTGGTGCAGAGTATGCCCCCCTACTTGCGCATGAAGGCGTGTCGAGCTGTCGCTGGAAAGCTAGCGT
TGATGGCGCGCGTGGACAGCCAGCCGCACCAAAATGACACGGAAGGTCTCGTGGGTGCACGCTTTCGGACTGAGCTAGTTGGTAAAATGGAGAAATGGCA
GGAACCTCAGAAAGCCAAGACGAAGAAGGCACTGCCGATCCCAGACGAAAAACCGCGACGTAAGCGCGGTGGCAAGCGCTACCGCAAGATCAAGGAGCGG
CTGCAGATGACGGATGTACGCCGTGAAATGAATCGGCAGTCTTTCGCGACAGCTGACGAAGAGTATGGTGACAACGCCATGGGAATCACATCCGGCCGCC
TTGGCCAGGAAGGATCGGGCAATTTGCGAATTATGCGCAAGGAACAGAAGCAGTCGAGCAAAAAGCTGCGTGCCGCGAACTTTGCTGCGTCGTCCGCTAG
CAAGCCACCGCTTTCTGGATTGGCATCGAGTCTTGCCTTCACACCCGTGCAGGGTATTGAGCTGATGAATCCTGAAGCTGCAAAGGCTCGTGTTGCGGAA
GCCAACAAAAAATACTTTTCAGCTGCTAGTGGGTTTGTGAGCGTCGTCAAGAAGCCGTAGACTGCCGAGAACACTGTGATCAGCCTGAAAAGATGTTGTT
GTCTTGCTCAAGTCAAGAAGATAATGATGCTCAAGGCACGAACAAGGGGAAACGAGCGGCTGAGCAATAAGAAGTTTTGGGTTTGACACGTTCGTGGTCG
GTGCTTTTAGTGTCTGTCTTGCCCTGACATGGTACTCTACGACGCTGGTTGATATCTCTCAGGTCTATCTACACTGGCCTGTCGGTCAGCTCAGTGCCCT
AAGATCTCGAACGTCGTGATCGATTGAGCTGGGAGACCCGCACTGAGTCTGGCACTCTGGCCAAATACGATGTCGGTGCTGGAGGTTTTGTATACGGCTC
CCGATGTTGTGTTCAGCTCCGTTGTCCAGATATTAATGGGGCCCTCCACGTACGATAGAGCCGACAGATCAAACGTAATGGTCTCTACGTCACCCAAGTT
CGTAGCCACGATGACCATCACTTGGGTAGCTTTGCCGTAAGCAACGACGAAGTTCGGGTATTTATCCAGGGCGTACGACGAGGATCCAGGAATGAGCGTA
TTGAGGTCGTCAAACTTGAGGATGGTCATGCCAGCACGGATATGACGCGAGTAGGGAACCATCACGTAGTGCTTCGGATTGGCCGTGCTGATTCACTGGT
CACCTGGGTTCGACTGAATAAGCGCCACTACTCCGCTGCCAAGAGCTTGCCTGTAGACGAAGGCCGATGCACCCATCTCATAAATGTCTCGAGCGATGGT
CTCCGCTATGGTGAGACCAGAGGTCGAATACGTCGGCTCCGCGCTTCGATGCCAAGCCAAGCATTGCTCGCTGCTTTGCATCCGCGTCCCAGTTCCAACT
CTTTGGGTCAGCACGGACCCGACATCAGTCTAACCAGAACGTCTCGATTGCATTGAACGCCGGCATGTTCTCTGACGTCTTTATGGCGATCTCCGTTCCA
CTATCATCGATGACGTTATTACCGGAGCCGCCGATGTTGTAGCGTGCGATGTTGAAATCGAGTGCTGGAATGTCCTCTGCGGCGCCATTAATGGACACCG
ACGACACGTTGGTGAAAAACACGTCGGCGATGTCTTCGCGGTCTCCGAAGACGTTGGCCCACCAGGAGAGCGAGGTTCCCCATCCTTCCCAGGACTCGAG
CATTGTCGTCGTCGTTACTGAAATCGTGTGACTTGAGAAGGTTGGGCGGTTAAGAGTGCCCAGGCCAACGTGGAGCTTGCAATCGATGCAGTCGTGAACA
TGTTTCTTGGATGCAGTACCAGTATGCTCTCGCACGAAGCAAAATGGTGAATGAAGAACGAGTTCGGTACATACCTGTATAAGCAGAGAATGAACCTGCT
CAATCCGTGTACAGTTCGGTCGCTACCGCAATCTGCGCACACAGGAAGGGATAACGTGGGTTGCAGCGTGTAAGATGCGTGGATTACACGTTATCGAGTA
TAATAACGCTGCCTTGTTTTCTCGTCCAGACAGTAAAAGTCGGCTGCAGTCTTGCCACGCGATCAGCTGGGGATCTGTGGATGCTGGGCAGGATCTGCTT
CGGGAACTTTCGACTACGGCGAAACTTGTATTAAATACATGTTGTTCATGAGCCCACGACATCGGCATTCACGTGTGTCGATGCAAACTCGCTTGGTTTC
CACATGTATCAAGTCGCAGACTCTGAGATTAAGACAGCATACGTTGGAACAATCCCTTAGCATTTCATTTTTACGTTCATTTGGTTCCATCAGGTGCCTC
CATGTTGCTCAAAGGAAGTACTCCTCGTACTTCTGCTCGTAAATGATGCAAAATCGTCGGTCGGGGGTGCGCCTAACGCGATGCAACGTGCCTGGGATGC
GGCCTTCCGTGGCTCGATGCAGAGCATGACCACAGAAAAGCACAATCTCCTTACCCGGAACGCACACCTTCTCGGCCTTAAGCCACTGTTTGGAGTGAGG
ATCGTACACATCCAGTCCCTCCACGCTCGGTACAGGCTCCACAACATACAGACTCGGATCGATATGCTCGAACACATTTTCCGTCTCGGACTGGCCGCTT
CCTTCAATGTTCGGGTAGTGCAATCCGTAGCAAACCGAAAAGTCTTTGTCCGATCGCGCACCACTCGGCTCAATATCATAGCCGACAGTCAAGCTCAATG
CACGGTCGCAGATGCGCTGCATGCGGCGCTGCAGACCCAGCCAGTGGTCCTTAAACTCTGGTGACGGCCACACCAGCCTCGACATGTCCCCGCAAGCCAC
TCGGAAGCAGTCACGCACACTCGTGTGCTCATATCCGCAGTACCAAAACGGTTTGCCATGCTCGTTGCGGTACACGTGTTTGCTTGTGCATCCGTTCTTC
CACTCGTCATCGTCGCTCGTGAAGAAGGTCTCAAAGTCCTGAAGCACTCGGTCGTGGATACGCTCCAGCGTCTCACCGAGCTCCGTGAGCACCACGAACG
AGTGGCGCTCCATCATCTCCAGAAAGCGAGCGCGGTTCTTCCAGTTGAGGTCACTCAGCCGCAGACGCGGCACTTGCACCGCATCGCCGGGAGTTTGTTC
AACTCGTTTTTCGACGGTCTCACATGGCCTCTGGACGTCGACGACGACGTCGGTAATTTCGCCGCTTGCATTGAGGCAGTAGTAACTGGCTGCCAGACTG
TAACCAGTCGGCATGGAGAAGCCTGCAGCGGTCATGTCGGTGTTGGCGCGGCGCGAGGATTAATGCACACGAATGGCTACGACTCCTTGGCCGTGTCTTT
GCGTCAGAGAACCGGGGCCCCACGTTTAGTGTCCAATCAACAAAAGTTCAAGTAGATGACCATCACTCTGGTTGTGCTGCTGACAGCACGCTACGGGCCC
GGTTGCCTAGCACCGTGGAAGTCGTTGGAGTGTACAAATCTACTGATTGGTTTATGGTATAAATTAGCGCGGTGCTCGACACGAAGATATGCATGTCGAC
ATGGCGAAGGGGGTACGCAGTGGAGGGACGAGCACCAGCAAAAGGTTTACCGGTACACGCTAGGCACGGCGCCTAGACGTCAAGTATCTTCGAGACGTGG
TTGCCTTTGTATTGGCCCCGTGCAACTGGTTGTCCTCCTTGTAGTCGAACAGACGCGAGCGCACCTGATCCAGACGACCCTGCCACTCAGGCGTGCGCGG
TCTCCGCGTCATGTTGCCAACGTGCTTGGTCTTGTCAGCGGCCAGGTTGCGGTTGCGCTCCTCAAGCTGACGACGGCGTTCGAGGTTCCTGGCTTTTGTG
GCCGCAAAGCGCGGCGAGCTGTCGTAGTCCATGTACCGAGGAACAGACGTCGAGATCGAGCGGCTTTTCGGAGACGTAACCACGGGTGGCGCACCCCGCG
CCGATTCCGAGAAATGGCGCGTCGACTTGACGGGCGGCGCAATGGTTGCTGAGAGCGACGAGCGACGAGACCTCGCGGGCGTTGGTGCTACTGGAGGCGG
GTTCTTAGCGGCATAGAGGGAAGAGCGTCGCGACTTTGGGGCCGAAGAGACTTTGTCCTTGGTAGTGGTGGACGGCGATTTGCCCGTGAGCGAAGCACGT
CGATATGAGTTAGGCGGGACAAGCTTCGAGGTCTTTGTCGATTGCAGGTTCTCAGGGAGCGACGAGCCTCTCGAGCGGTAGACGGTGGGCTTGACATTCT
TGGAGGCTTCAGCACTGGTCTCGCCTGACGCCTGCAGTAGATCAGGCAGGAAGATGTCGAGCGAGCTAAGAAGCGAGTCCAGGGAGCCCGTGGATGCAGT
GGAGTAGGACGACGGGCTGGGAGGGACAGCCGAGTAGCAAGTGGATTTGATCGTAGTCGTTGAGTCGGCATCGCTTTCGTCTTCGTAAGAGTTAAAAGTC
ATGGGGTCATACTCATTGTCGGACTCCAGCGTGTTGACTGTGAGGCTCCTGTAGACCGCAGGCTTTGTCGGGGTCTCTGGCACAGCAACTGGGGTCTCCC
CCTCAGCAGGTTCCGTGACGTCCTCTGTCTTCTGCAATTGTGCAGGCTCCGACTGAGTGCGGGTGCGTTGTGTGTTCATGCGCACGATGATTTCCTTCAC
CGGCGAATTTGGCTGCAACGGCAGATCCATGCGTTTAGATCCGCCAACGGACCAGGAGCGCGGAGTTGCAGCATTGGCCTGCGCCATGAGCTCGAACCGG
GCGATGAGAGTCTGCACACTCGAGGTGCTGTCCATTTTAATTGCCTTTGTCTCGGTGGACGACTAAGATAGCGGCGAGAAGCGTTTCCGCGATGGGAATC
TCGTTCGTGTGAGCTCTGCGGGTCCGAAGCGGAACTGGCAGCGGTCGACACTAGCTGGCAGCGTTTTCGTGCTCGGCTTTCGGGGCGGGGCTGGCTCTTC
CAGTCCTCTTTCTGGCGCTCGCTGAGCTCGTAACTCGTCGCACCCCAGTTGCCCGGCCAGTTCCGAACTGACCTGGCACAAAACGCTTGGTGCGGATGGC
TTCAACCACGGGGCCCGCGCCGTTTCGACTTTCGCCAATCGTGGAGCTTATAGCGCATTAATGGCCAGTAGTGAGCCGCGATATTTAGGCGGGATAAAGA
TCGCAGGTGATGTGTCCAGCGACATATGCTGCGACAAAAATTCGATTTCCGGCCCATGCCGCTGCTAGCAACTCTGACATTTGATACTGTCGTATTTAGC
AAACCATATAGACAAGCTATACAACAACGATTCCAAACATGATAACCTACTCTTCTGACATACTATGCTTTCCCGGAGGCCTAGTTTAAAACGGCCAATC
AAATGAGGCGCGTCACATGCTCGCCTGGATCTGCTTCAACTTGAGACCAAGTGTCAATTCACTGTCAATGAGGCCATGTATCACAGTTACCTGAGGCGAA
ACGCTAGAGCCGCTGGCGTCGATGGCCATGGGCGCAGCTGCATTGGCGCTCGAGGACTCGTGCGGGTCGATTGCTCCGGTGCCGCCGCGCCCTTTGCCGG
CAAACAGGCTAGGCGTCGGACCTCAGCGCGTCGGAAGACCGTTTCTTGCGGCGTTCTCGCTCCTTTGCGATTTGCTCCTGCACGAAACGGCCAAAGGATT
CGGCCAGGTCGTCGATGCGCTTCTCGTGCTCGTGGTTCTGCGCCGACAGCTCGCGCTCCAGCCGCAGCACGTGGCCTTCGAGCACCGCGATCGCCCCCGC
CTTCTCCTTCAAGATGGTGGCGCTCTCCACCGCCGCGATCTTTGCGCTGGCATTCAGAGCCTGCAAAAAGACACAGCAACGCATCAGTATGCTGGGCAGG
AGGCTCTGACAGACAGCAAGCGAACGTACATGGATCCGTTCGTCGAAGGTTGCGTGCATCTGCACGAGTCTGGCGTCCTGCTCTTCTAGCCTCCGGACCT
GCTGCTGCAACTTCTCCTCGCACCGAGATCTCTCGCTCGTCACTGCGGCTAACTGCGCCTGCTTCTCCTGCAACGCCCTGGATTGCGTCTCCGTCGCGGC
CTCGAACTCGCTCTGCTTTTCATCTCGGGCTTGCTGCAGCGAGACGTTGTCTTGTCGGAGCTGGATGATGGTCTCGAGGTGTTTTTCCACTTCTCGCTCG
AGGTGCTGCCGCGCCTTCTTCACCTCGGCGACTTGGGCCTCCACCGATCCAACAGAGCGTTGGATGCGCTCCTGCAGCTCCGCCTCCCATTGCTGCTTCA
GCTCTCCGACTGTCTTTTCGTGGCCAATTTGCGACTGCAAAAGCTTGGCCTGCAGAGCCTCACATTTCTCTTTGAGTTCGTGCACACTGCGTTCACTTGC
TTCTAGCTGAGTGGAGGTGTAACTAAGCTGCGTCTGCACAGAGCCAACGATCATGTCGTGCTGCCGCTGTGCTGCGCTCATACTGCCTTCGTGACCCGAC
ACGAGCTTGGCTTCTTTGCGGCCATACTCTTGTTGGGCATCTTGGAGCTGCTTCTGCAGCTTACCGATTTCTTCTGCTTGCGTTCTGCACAGCATTTTAG
TAACTTAGCACGACCATTTCCATTACTAAAAGCAATGAGTCGCCTACCTTAGTGTGAGTGTTGAGCGATGTACTTCGTTGTCGAGAGCATACTTGACCTC
TTCCAGCTGCGAGATCTGCTTGTCTTTCTGTTCCGTCTCCTTGCTTCGCAACGTCTCCATGTGCCCCATTTTCTCGCGCACAACGCCATTTTCGCGCTCG
AGAGCAGTGCGTGCGGCCCGGTACTCTTCGAACTCTAGCTTTCTTCGGTTCTCGAGTTCATCGAGCTGCATTCGCAGTTCATGGACGTCGCGCTTTGCAT
CGATCTCACGCTGTTGATACCGATCCCGTTCTTCTTTGGTCATTTCAGCGTCTTTGCGGACCTGCTGCAGCTGCGCCTCGAGCTCTTCCGTCGTCTCCAC
CTGAATGGCAACAAAGCTCATCATTAGCCCTCGCCATCTAATAGTAACAAATACTTCGTAGTATGTGCACCATATCTTACCATTTTCTGCAGTTCTCGCT
TGCCTAGATTCCTCTCTAGCTCGAGCTCTTCTTTCTCCGCCAGAACTTGTAGTAGCAGTTGGTCATCCCGAGCAGCTTTATGGATCGAATTGTTGGATTC
GACATCTTCATCGGGTTGGCACGACGCATCTACGGCCAAAGGTGGCTGTCTTCCCGAGAGCGCTCGATTCCTTGTCAACAACTCCTCAATTTCGTCCACG
TGCTTTAAGCTGCTATTGTTCCCCATGAGCTCCAGTGTCACGAGCGAGTGGTTGCTCTGCAATGCCTCACGAAATGAGAGCACGCCTGGGTTTCCGACCT
CATTCCAACGCAAGTCCAGTTGACGTAGTGAGCGGTTAACTCTCAAAGCTTTTGCCAGCGCCTTGGCACCCTCGGGCCCAATGTTGTTGTTGCGCAAGTC
GAGCGTTAGCAACCGTTTATCGACCTCCAGCGCACCGGCGAGAGCTTCCACCCCCTGATCCAGCAAGCCAACATTATTCCACTCCAGACTGATGGCCACC
ACATTGTGCGACGAACGAAGCAGCGCCGCAAGCGCTCGGGCAGCCCCAGCTTCGAAGCAATTCCCTCTCAGATCCAATCGAGTCGGAACGCTCGCAAGCC
GAGCCTTCTCGACAATCTCCGTGAACTTGTCGTCTCCCAAGTACGAGTTGCTGTAGTCGAGCACTGCGTCAACGGGCTGTTTGAGGTGCACAAGGGCTAC
AGCCTCCGAATCCTCGACGAGACACTCGCGCTTCGCTGGGATCGTCATGCTTGTGACAAGAGTCGTTTCGTTCAAAGCACCCGCGATCTTTTAGATCCGG
AGCCTGTTCAACCTGTACATGAAGCTGCTCGTTACTGAGGACACGCTTGTCTCTGTAGTGCGTATGGCCGACACTGCTCTAGTCAGAAGCTGGAGTCAGC
GTGGTAAAAACTTCACCATGCAGCCGGTTGCTGCAAAACGACTGATCAAACAACGGACGGCTTAACATATTGCACAGCTCGAACATGTACTGATATCCCC
ACGTGGTTGGCAGCTAAATATGTGTGGAGCTTACCCAGACGCTTCCAACTCAGTCGATTTGGGTTGCAGTCGATTGGTCCTGGTCATCAAAATTGTAGCA
ACGCCAGAAGTTAAGTCCCTCTAGTACTAGCCGAGCGTTGTCGATGCCTGAAAACTACTAGGACAGGCGAAAGCCCTTCAAACATGGGCGCCACGAATGA
ATTTGAAGTTGCAACGGGCACTTGGTTTGCAACACGCACGCCACTTATACTACACGTGGATGAAAGCACACTGGCATTCACATCGAGACTCGCTGGTGAA
GATCATGGGATGTCTCGCCACCTGGGGCTCTGGCGTGCGCTTACAGCACACTGCTGTTTCGACTGTCAACAGCATTTGCCAGGGCAACTGTACAGGTGGG
GCTTGGAGGATCTCCCAGATGTACATGTCATTGCCAGCCGAATAATACTGCTTGGTTGTCGGGTATTGCTCTGCCGTTCGTTACTACACGATGCAAGAAT
CCACCTGATAATTATAGGAGTCCAAAGCTGGCAGCCTCACTCTCGAAAACGCCGCGTAAGTGGTGAAGTCTACTTTCTAGTTCATAATGGCCCCCGTCAC
CAATGCTCCTCTGACGCTGCATTCGCGGATCCAAGAAAGTTTTGATGGTCTCCAGTGTGTGGACCTGGTGGAGTGTGCTGCCTCCGGGCGCCTATTTGTC
GACAAGCACACCCTCCTGACCTCCTCCACCAGTGAAGGTCGTAATGCTAGTGCTGCTGCATTGAACGAATTGGACCTCCACCTTTCGGTTCGAGACGCCG
AGAACGTGGTCAAGCTGGAACGGCATTTGCTGCAAGGAGAAAGACTCCACCTACTGCATGAACACTGCGCCCGCGGCGACCTGCTTGAAATCATGCAGCA
AGAACTTCGCCTTCAACGGCGGGCGTGCCACCTCACAGCTCTTCGATGATGACCTGCTCTGACGCTGGGAGACGCCGTGTTTTCACTGCCGTGCTTCGAG
GTGTGCAGGCTCTCCACTGCGCTGGAATCGCTCACTTGGACTTGTCACCGGAAAACGTCTTCGTCACAGACTCAAGCGTCGCGAAAGTCGGGGATCTGGG
GCACGCCCAGCGATTCAAGCACGAGCGACCAAGCGTACAGGTCGTACAAGCTGCCAAGGAAGCGTACGCTGCACCGGAGCTGCTAGCTCGCAAAGACGTG
GAAGATGCACGTCAAGCTGATGCCTGGGCTCTAGGCGTCATCCTGTGGACAATGTGCACCAAGCGTGCTTTCGTGCGTCGCGCGTGTACTGACAGCGACC
AGTTATTCTGCCGCATGACTGAACGAGGCACTGCGTTTGCTCTCCAGGAGACTGGGCTGCTCTCCCAGATGCCGGCCGCGATGGTTGACCTGTTGGCTGG
TCTCCTCGATGTGAACCCCAAATCAAGACTTACGGTGAGCGCAGCTCTGCAGCATCCGTGGGTGAAGCAGGAATCTGCAACAAGTAAGCAGCAGTCTCGA
CGCAAGTCCATCGGCAATATGTTCAAGAAGAAGGGCGAGGAGCTGATGAAGAAGCACCAGCGCCCAACCGAGAAAAAGTCGCGAGGTCGCACCGCAAGTA
CTGAGATCGCACTCGAGTCTACGCGTGTGGCCTTGACGTCCCGAAATCTAGCTTAGAAGCCGACTAGCATCCACTCGTGTCTAGCACTAGAACACGCTTA
TAAGCGCTCTTTACGAGCGCAGAGCCCAACTATAAACGGGATAACATGAAACGAACGACTGCCGTCGACGTTGCCCCTCTAAGCCGTCGCGTCCGCTTGA
TCAACTCCAGTCGCAGAGGAGCCCTCGAAGCTGTGCTATCTTTCGACGCAGCTTGGTAGCGTCGAGACGGGTGCAGAGCTTCGATGCGTCGACACTTCCT
CTTCGCCGAGGATGAAAAGGAACGTAGTGTTGGGGACGGCAAGGCCAACCTGCTACGACTATGGCACAATCGACGAAATGCGATGCTGGAAGGTGACGAG
TCCGCCGACGGGGGTGAAGCGAACAACGCGTTAGTTGGTCGTGAATTGACACTGCTTTGGGATTTAGCCAAGCCCCTGAATTCACGTACTTTGCAGCGTG
ACGGATACGTTGAGTTTTTCGCTCGAGCAGGAAAGGCACTGGTACTTCCGTTGTCAACCGATGCGATTGCGATCCTCGCGGCTCGACGCGACTGGGAGTA
CGATTTAGAAGGTGTCGGCAGCGTCAATGAGTCTACCAAAGCAGCTTCAAGTCTGGACGCTGAGGTCATGTCAGCCGTGCAATTCCGCGAGGCAGTCATG
CAGCTCGCGGAGATTATCTTACCGGTTGAGAGTGCACCCAGCGTTTTCGCGGCCTTCTTTCGGGATCTACGCAATTCTGTAGCGGAACTCGCTGCCTCTC
CTTCAGGCAGAGAACCGGAGCAAGATGAGACCAATTCCACTGAGCCGGTTGACCGCTTCACGCTTCGACTATTGAATCGCATCCCGAAAATTGCGAATGA
CGCGTTCCTGCAAAAGCTACCGCCTTCGAGCGAGGCCTTACGAAGTATCCGAGGGCTTCAATCTCCTGATCAGCGTGAGATGTCACTCAAGCAGCTTCTT
CTGTGCTACAACCCACGAAAGTTTTCACTCACCCGTGCGTTTTCCAAAAAGAAGGGCAGTGACACCAAAGTAGCAGAGGAAGCCAAGGCAGATACCGTTG
ATACTCCTCAGCCCGATGTCGAAGACGAAATGGCAGTGGCAAAACGTTTGCATCTGGAGCTCATGGGCTCTATTGGTTCGGGGGCAACCCCCGTCCGAGG
AAGAAAACTCCACCGTGAAACTGCAGCACATCGGAATCCCGAGGATGCTCTTATTGCAGCTCTGACCGAGTTTCCTGCACTAAGAATTGCAGTGGTGGGG
CCACCTGGGTGTGGCAAGACTCGACTTGCCCGTGTGCTAGCTCAACGACTTGGACTAAGGTATTTGTCACTTGGTGGGGTTATTCAGCGCGCGGTTGACC
ACAAGCTCCGCATACGTCGACGTCGACCTGCCGTCATTATCCCTGTAGAGGGAGAGGACTCAGCTGTGGAGACACCTCTGGAGATGGAGACGGTGGAGGC
AGACGAGGAAATCGATACTGACAACGCTGGTGAGGACGAATCTATAGACCGGGTTTTTCGAGATGAAGATCTCGATGCTCTTTGTGCTGGAGGTGTGGTT
ACTCGGAGCAAGGCACTGGATCTGTTTCGACTGGAAGCCACTCGTTCTTTACTCGGTACGTTCTGCAGCTTTATCGATGATGAAATCAAAGCGAAACTCA
CTATTTATTCCCTTCTTGTAGCTGGCGTCGGTGTGATTATGGACGATGTTTACCCGTGCGAACTTTCAATTTCAGATAACCCAGGGCACAGCATAGCAGT
AGACTACTTGATAGCCCTCACAGCACTTCCCACCGAGATAGAGCACCAATTGCAAGGCTCACAACTAGCACCAGCAGCGGGCCGTCTGTACTCAGTACGA
GAACTTGCCACGTTGAAAGCAACACACGCTGAGGGGTTGGTTGCTGAAGGCTTTGCCGATTGTCTACAACCACCGAAGAAACCGGAGGTTGATGCCGAAG
AAGTGCAGGAGCCCAATGGTAGTACTGCAAACGGTGATGCCGGAGCTAGTAGCGAAGACCAAGAAGTCGACGAATCTCCTTCTCCAGAGGAAAATGATGA
GGAAGGAGACGGTGGACAAGTTCTATCAGAAGAACCTGTACTACCACCGGAACCAACTCCTGCCGAACGCAACGAGATCGAACCTCCCGGAGAACGCACG
TTGCCGTTTGGTTCAATAGCGATGGCAAAATTCACCAAGGGATACCACGAATACGTGACGCGAATGCAGCGAGAACTTTTAACACGTCGAGTTGCTGACT
CAACGGAAAAGCGATCGGATTGTCATTTGGTGGTGGCTCTGTCAACTCAGTCTCTCAACGTGATTCGAGACCACTGCATCCAGACGATCACGGGTGTAAG
TAGAGATGCCAATAGTTGTGCGCTTGTTTTTGGTTTCTTGACATTCGGCGTGCTTGTATTTTGGTGCTGTACAGACGCCTCTAGGCCTCTCGCGCTTTAG
TACGTCGCGTGAAGCTTGTCAAGTATCTCTGCCGGAGAATTTAAATGGTTCCAGCCGCGCTGAAAAAGTGAGGTGGCTACTCTACGGAGATTGGGCCGCG
CTTCTTGAAGCCGAAGCAAGCTCCACCACCGAGTCGTTCGCAAGACTACCAAGACGTGATGCAAAACGCCGATTGCTCTCGAAGTGGCGAGAGTTTTGTC
CTGTAGTCTCGACTTCTGTTGGTGCTCTGACATTAGGCGATCCTGAGTTTGCAGCATGCTACTCCGGTCGGGTCTACCTGCTGGCTTCACAAGAAGCACG
GCGTGCCTTCTGCGCATATCCATTGCAATTCTTGCTTCGAGAAATTCCAATTCCGTCCAAGTGTCGGAACTTCTGGCTCGTAACCACAGGTACAGGGGAT
GCCTTCACGCCCTCATACCTAGAGGAGCTCGAGGCTGGGCTCCATGTGCAGACCGTGAGTACTTCAAAGCTCCTCAAGACTTCACCCAGCATAGCGATGG
AAATGCGTCTCATGAGCGGACAAATTGTATCCCCCGTGGAAGCTGCAGCGATAGCCTCCGATGCTGCCAAAACGTTGCTGGCGAAACAAAACGCGTCTTC
TGGGTGGATGCTCATGGACTTACCGCTTACGCGTGATGTCGCTGCCGCACTGCTCGAACACGGATGTGTCCCCGATGCAATATTGCTGCTGGACAGAGAG
GTCGCCGCTGTTCAAGAAGATGGCGAAGGAAGTAGTGCCGCCAACATGAGTGCTTTATCTGCACTGCGACGTCAACAGTTCCAGACTGAAAAGGCTGGCG
CTGAGGACGTTTCACAAGGAATTGGAGGTGTTACTCGGGTGATAACGTGTCCATTGTTCCGTCAGCCGAGTGACACATTGGCAGCCATCGAGCGAGAGCT
TAATCCAATCGCACCACGTTTGGACAGGATCGAAGACGGACATGCTCCAGAGCTAGTTGATGAGTACGACCCAACTGTCATATTTGCCTCACCACTACCG
GAAAATGACGAAGTTAACGAAGGAAAATCAACATCAACTTCAGAGGAAGGAGATGAAGTCGATGTCACCGACCCTGAAGCGGAAGCTCAAGCCAAAGCAG
CAAGAAGTAGAGCTCTGCAGCTTCAGGGAGAGTGTGGACATTTTTGCCCCGTGACTTGGCACACCCGTGGTTTGTTGATACCTGGACTGCCAACCAACGT
TTGCTTGTTCCGCCAGAAGTTCTATGCCTTCGCTGGAGAACAGGAGCGACTTGCTTTCGAGCGAAATCCAGCAACCTTCATCCCAAACGGGCCTCGGTCA
ACCACTAATTTTGTACCATGCGTATTGGTGCTTGGTGTTCGAGGATCCGGACGCGGCCGGGTCACTGCGGCACTTGCTAAGTCTCAATCGGATTCCCTCG
TGGAATATCTCAATCTGGACTTGACCGTTGTTGCAAATAGAGCAGAACGAAGACGATTGCTAGAGGAGCTCAAGCCGGAAGAAGCACGCATGACTTCAGA
GGAAATGTTTGTCGAATCCCTTCAGCTCGAGCTTAAACGTCAAGAACCAACACCCAAGAAAGCTGTAGCGCGGATTATCGCTGGACTGGGGTCAGAACCG
TCACGCATCCCAACCACAGCGATGCTGGAGATGTGTTTCAAGCATGGACTCGTTCCAGCACTTGTGGTTCCGCTGACAGTGTCAGAGGATGACGTTGTGA
ACACCTTGTTAGATCGATGGGCTGCCAGCTTACCGACACCTCGCCGAAAGCTAGCTCTCATGCGAAAGAAAGAGGCTGGCGCTGAAGGTGAGGACGATAC
TGTCCCCGAAGACGAAGCTGAGGAAGAAGAACCACCGATCGACCTGGAAGAAGCACGGGAAGAAGAGAGTACTCGACTGCACGAACAATTTACGGAGGAC
CAGAAGGCTCTGGATGAGGCTATCGCTGGACTCCGAGCGCGAGGTGTCAGGACCTGCAACCCGATAGACGCTTCCGGCGCTTCAAGACAGATAATCAAAA
ACGTAAGACGCCTCCTGAACGACTTTATGGCAGGACGGGAGACTCTTCTCGAGCACTGCGAAGTGATCGACATGCAGCGGGAGGCACAATGCAGCGGCTA
CTAGCATCAGGAGAACTTCTTGTTGGCAAACATGGAGCTTCCTGTCCCGTGACAGGACGTACTGATTCCTTATCGGTTGCCTCTGTGAAAGCTGTAGTGC
ATCGAAACCAGCTTTACTTTCCACGGTCACGCGAGGCACGTCGTGCTTTCGTGGCTTGTCCGTCACGCTACTTGGATAAGCCTAGTCTTCCACCAATGCA
TCAATTGACATGTTGTGTGGCAGGAGCTCCATTTTCAGGCAAGACGCGTGTCTCCCAGGAACTTGCAAACGCACTTGGACTGGTCTACGTATCTCCTCAA
AACGCAATCGAATGGGTGATGCAGTGTCAGGGTGGATCGGCACTGCGGCATCGGCTGCAGGAGATCACAAACTTGCAGCATGACCCGCTTAATGATGCAA
GTGTCACGCATGAGGTTATATGTGCTCGTCTTCGCTCTTCAGAGTGCCAGACACGTGGTTGGGTTCTTGACGGGTATCTATTGCAGCGCCATGAGCTGCA
ACGCAGTCTTCCACATCCGGATTCGACAGAGGCTTCATCACAATGTATTCAACCGGACATGCTCTTCGTTTTAGAGTGCAGCTTCCAGAGTGTTTGGAAG
AATCACCAGACTCACGTTGACAGGAACGAGCTTCGAGTGGCATTTACACAATGGCATCAACACCGTCTAGAGCTGCTAGGCGTTTGGACGCGAAGCTATG
GTTGTTTCCACGTTCGGCAACTCGACAGCTCCAGCAACTCGCTCTGGAACGTAGCTGCACAAGCACAAATATTTCTCGAAGAGCAACAGCAGTTGGCATC
ACACCACACGAGGGCGATGGCATCCGGTCGAGCTGCCCGCTCATTAGGTGTGGTGCGCACGGATGAAGAACTTCAGGGGCGCCAACACAATATTTTTCAG
ACGTTCTGCCCTGTTGAGCTGCAGGCAGGGAAGTTTTACAACTCTCGCCAATCAAGCCGTGACCTATGCGTCGACTTCCGAGGCTGCAGTTTCTGGCTTG
GAAGCGAGCAAAACCTTGAGCAGTTCGTTGACAACCCTGAAGGCTTCGTTGGGTATTTACCTGAACAAACTCCACTTGAACGGGGAGAAGAGTCGTGGCC
AACGCAAGAAGACGCAGAAAGCGAGGCACAAACTCTTGTCGCAAAGGCACCAGTGAACGCTTCGCTGGTGAGTCTGCTCACCGTGCCGGACTGTGACTTC
CCTGAGATGAAAGGCTATTGCCCCGTCACATTCGCGTTGGGCTCGGGCGACAAAGATTGGGCTTCACTCCGTCACGGCAGTGTTTTCTTCCGCGCATCGT
ACCGCTCAAAAGTTTACTTCTTCGTCTCGGAGGAAGCACGGCGTAAATTCTGCGCTGAGCCCTCTCGATACGCGTCACAAAGTCTGCCGGTCAAGTTACC
ACCCCAGGTGGCACTAGCCAAAAGCTACCCAGGTCAATTGGAGCAGAAACTTGGTGCTGCACTCAACGAAGTACTGCTAGCGCTGGGTTGTGAACGTCCT
AAGTTCCCGCAGATGCCGATGCGTGCTTCAGCATGCGTATATCTCGCCCTCTCACTCAAAGCCCTGCAACGCAAGTACCAACTGAAAGTAAAGCCTGACC
CACGCTCAGCTCGAGACGAAGACGAACCGGACGAAGAGCAGAAACAACGACAGGAACGGAGAGAAGAGCAGGCCGAGCGGGATGCGACCGCGCGCCGTGA
CGCCTTCGTGCGTGACTGCCGACTTGGGGAACAACTAAAAGTTGCTTCCACTCCGACACACACATCTTGTGGCTCTGGTGCAAAGGTTGCACGCAGCATG
CGTGCTGCACACGACTCACTGGCAGGCAATGAAACGGAGAGCTACATCTCACCAGCACCTGCCAACGAAGAAGTTGATCAGCTTCGCCACCGTTTCGATG
CTATTGTCTCCGGGAGCAGCAGTGCCGATAAAACGCTATCAACAGACCCTCGCTCAGCACGAACACATGCCAGAGCTGCATTCCTCGAGTACATCAAACC
TTCTACAGCAATTTAGCAAGATCAGAAAGATGACGAACTACACTTCAGCGTATGCATCAAACAAACCTGTTGAATTTGAACAAGTACATGCATATCTACC
TTGTCCTTCGTCTCAGCGCAGCAGAGGTGTCGACTCGGTCACGTCAATTGCCACATGATCCTGTTGCAGGCCCCAGTTACCACCGAAAGGTGGCTTCCAA
AGGTTAAGCAGAAGTGAGAATAGGATCACGGGCACAGACGAAAGCAGCTCCGACAGACCAGCGAGGGCCGGGGGGATCCAAATTCCAAGGGGCCCATACA
GCGCACCGCAGGCCACAGGCATCATGAGCAGATTGTACATGAACCCCCAAGCGAAATTGTGCTTAATGCGTCTGTTGGTTGCGCACGAAAGCGCTCGGGC
ATTCAGTAAATCGCGCAGATCGTCCTTGACGAGCACGACGTCGGCAGCATCGAGGGCAACATCCGTTCCGGCCCCAAGCGCCACACCGACATCAGCTGTG
GCTAAAGCTGGTGCGTCGTTCACACCGTCGCCCACGAAAGCTACGCGCAGGCCAAGACTCTGGAGCAAGCGAACCTTGTCCACCTTTTGATGAGGCAGGG
TTTCAGCTAGCACAGAGCCTTCGGGCACGCCTAGCGCCGTCGCCACGCTCATCGCTGTTCCACGCTGGTCGCCTGTTACAATCCATGGCTGAATGCCCTC
GCGCTTTAGCTGCTCGATAACACGTTTGGCTTCCGGGCGTGGAGTATCTCGCAGTGCGATAGCAGATAGCAACTTGCCATTAACAGCCAAGAAAACTACA
ATGCACCCTTGTGATTGGAAACGATGATTCGCCTCGATGAACTCGGCATGGACCTGCAGAGAGCCTGAGCCACCGTAACTCTGCTGCTTCAGCCACGTGA
GTGAACCGAGGTGTACCTCAGCACCATTCACAGTGCAGTGCACACCACATCCCGGGATGGCCTCAAACGCTTGTGCTTCGTCGATCTGAGATGCTTGAAG
CCGAGTCTGAGCATGGGCAACAAGTGCTTTCCCGATGGAGTGCTCACTGCCGCTCTCTGCTGCAGCCACAAAGCGCCAGAGCTGGTTTCCATCAAAATCA
TCGTGTGGAGTATAGAATACACCAGCAACCCCAAGGCGTGCTGTAGTGAGTGTCCCCGTCTTATCAAAGACGACCGCATCAACCTCTTCCAGCGCTTCAA
GTGCGCGACCACCCTTAAAGAGTACACCGACCTGCGAGCCTTTTGTTGTTGCCACCATCACTGCAGTTGGGACTGCGAGACTGATGGCACAAGGGCAACT
AATGACTAGCACCGTGATCGCGAAGCGCAGCGCAAACGGAAAAGGAGACCAGCCTTGCGTATCCACGTGTCCATGCTTAGCGAGCGAATACCAAAGCATG
AACATACATCCGGCCAGAATGATGATGAACGTGGTGAAGTATGCAGCCACAGCGTCCGCGATACTTTGGCGCACACCACGCGAAGCCTGAGCCTCCCCTA
CAAGACGCACCATTCGCGCCAGCATAGATTCGTGAATGGTATGCGTCACACGCATGGTCAGGACACCTTGCAAGTTTATGGATCCACCAATTACAGTCGC
GCCGGGTTCCTTGGGCACCTTGCGAGCTTCACCCGTTACCATCGACTCATCCACAGAACTGGCACCTCCCACAACCACACCGTCCGTAGGAACTCGCGTA
CCGGGAAGCACTTTCAGCAAGTCGCCATGCTCCACAAGCACCACTTCAATGTACAACTCCTTCTGGTCTTCGCCCTCAAGCAGAATTGCAGTTTTTGCCT
GCATGCGCAGCAACGCATCAACACTGTTTGAAGCACGCGCCTTCACCAGCGTCTCGATGTATCGACCAACAAGAATGAGAGTAATCAGGAGCACCGTGAC
TTGAAAAAAAGTCTCCGTCTTCACTGGTGTTTGCTCTTGTGGAGGCAATGAGGGCTCTTGCACCAAAGGATCCACCTCTACAACATTAGATGCTTGATAC
TTTGCGATCGCTTCTGTCGCAACTGTAAAAACAGAAAACGCGTAGGCAGTGCAGGCGCTCAGCGAGATGAGGACGTCCATAGTAACGCGTCCGCCGTAGC
GCAGCGCAAGGAAAGCACTTTCGTGAATAGGGAATGCCACAAGGAACAACGCTGGGGTCGCGCACGCCAACTCCACAGCGTCTCTGATGCTCAAAAGATT
CGCGGTGCCCCAGACTGCTGCATCTGCTAGATTAGTGTCGGAGGAAAAGAACGCTGGTAGCACAAACTCGACGAAGATCACCGGCAATGACAGCAGACAG
CTCCAGAACAACAGACGCGTAAAGCGCATCACTTCTTCCTCTCCTGCGCGGACCGATGGCGCCCGCGGGCTTGAGGCTTGAACGGTGAATCCAAGCTCGT
GCGAGAGGTGCCGCACTATTTTACGAGCACCCGTGATATCCGGGTTGTACTCAACCAGCAACGCCTTACTTGATGGTCCCGACGAAGCTGGTGGCTCACT
AACATCTTCAGCCGAAGCGACACCAGCGACCTCAAGAACCAGTGTTTTGGCTCGTGGCACGATTTCAGACTGCCCAAGGTGTAACACGATTCCCACGACG
TCGTCACCAGAGAGCACACTCGGTTCAAATCCCAAGGTGGCTACGGTCTCTTCGATAGCCTTCGCCGTCACTAGCTGCGGATCAAATTGAAAGACGCCCC
GACTCGTAAGCAGGCTCACATTCACGTCCACAACACCACGCTGTCCGGCCATGAACTTCTCGATACGCGTGCAACAGCCGCTGCATGTCATGCCACTGAT
GTTGAGGCGGAGGCTCTCCAAGGACTCGGTCGTGTTACTCTTCCTACCCGAGATTGACCGGGTCTTCTCGAGAGTAGCCCCACGATCGTTGCGGAACTGC
ACCAAGCGTTTCAAGAAGCTGGGAGATCGCTCCGGAAGTGACAGGCCCTTCGCATTCGACGAGCAGCAACCATCGGATCGTGTCTTAGACGCATCGGATG
AGCAGCAACCAGACGTCTTCGGCTCTTTCGTAGAAGCACAAGAGCCGTTGGCTTTGCCCTCCGTCTCGCCATTTGCAACCTTCGACGAACAGCAACCAGA
GTCACTTGGGGTCTTTGACGGCTTCGACGAGCAGCAGCCAGACGCCTTTGTCTTCTCCGTAGTAGTACAACAATCATCAGACTCGGTCGCAATCTCGGCA
GTCTTGTTCGACGAGCAGCAACTGGAATCGTCAGTGGCCTTCTCCTTGTTTGACGAACGACAGCTCGACTTCTTCGGCTCTTTCGAAGCGCAGCAATCGT
CGCGTTCAGTCAATACTTGCGGTGCCTTGGACGAACAGCAACCAGCACCACTGGACTCGCCAGCAGCGTCCGACGGGAAGCATCCAGCCTTTTTCTCCAC
CCCCGAAGAGTCAGCCTCTGCAATCTTCGACGAGCAGCAGCTCGGAGGTTTCATTGTCTGCGCGTCCACAGCCACCTCGCCTTCTCCCCCACAGCAACCG
TCAGCACAACCCGTTCTGCTCTCCGTCTCCTTTTTCTTGCTGCAGCACGAAGTCTCGCACGTCTTGTCTGGCGACTCCTGGGTTGTGTCGCTGGCCTCCT
CACCGCTGGAGGAACAGGACGCTGACGTCTCTCCGCCGTCGCTCTTGTCGCAGCAGCCTTCAGTGTCCACGGGGCCCGCTACCGCGAGCGCTCGACAGCC
GTTGCGTTTGCCCATTGGTACTACTTGTCCAGCGTGCAGCGCGTTGAAGTCTGCGAGTTTGGAATCGACTTTTCAAACATAACGCAAAAGTTAACTTGCA
GCAAGCGCAACTTGAAATTAATGCAGCACAACTTAAACGTACAGCAACGTAAGCAGCGCAACTTTATTACGAATCATTGTGTAATCGAACCGCAAGACCG
GTTAGCGGGTAATTGTAACCGCTGAACCGTGCTGACCTGGTACATTGTACCATATGCATGTACGCCACACCAACTTGTGGTTGGCTGTGGTTTGCTCTGC
GCCAAGTCGTCTGCACCCGGCACCGCTCAGTTCTTTTCAGACAGGTAAGACACGCAAGTGTGTGGGTTGGACGCCTCAACGCCTCCTGACCTAAGTGTTG
TGCTTGTTTCCTCAGGTATATTCATCACCATGCCCGCTACCAAGACGCAGAACGTGGTGCTCGCCCGCGGCATCAACGCCATCTCGGCCAACAGCCTCTC
GAAGAAGAACGGCCGTGGCAAGGTCGTCAAGAAGGGCGGCGACAAGAAGGTCGTGGCCAAGAAGGCTACCACCACCAAGAAGTGGTACCCTGCCGACTAC
ATCCCGAAGCCGCTCCAGTCGGCCAAGACCAAGCGCAACAGCGTCAAGACCGCCAAGCTGCGCAAGTCCATCACCCCTGGCTCGGTCCTGATCCTGCTGT
CGGGCCGTTTCCGTGGCAAGCGCGTGGTCTTCCTCAAGCAGCTGGCTTCGGGCCTGCTGCTCGTGACGGGTGAGTTGCAAGTCTCTCTTTTCGGCAGAAA
TGGAGTGCACAAAAGTAGCGGCATTCCGATGATGCAAACTTGACACTTCGAGAGGCACTCTGCCGTCCCCTTCCTACGTTCGCTTATACCCTCAAGCTTC
GTACTTCGGCGCCTCATCCCGATAGCTTCCTTGTATGAGGTCTGGCTATTGGTGCTTTGGCTCGGGGTATGCGGAGCAACGCTGAGGGTCTAGGTGGATG
AAGAAGGGGTGTCTTTTTGCCAAAGATCCATCAGATTATGAGACCTGAGGAATGCCGGCTCTAGATCTCCTGCCTTGTGCGAGTTGATGTTGCTTTGGAC
GCAATTGCTGACATCAGATTGGGATTATTGATGTATTTCAGGCCCCTACAAGGTCAACGGTGTTCCCCTTCGTCGCGTGAACCAGTCGTACGTGATCGCC
ACGTCGACCAAGGTCAACATTGAGGGTCTGGAGCTCCCTGCCATCGACGACGCCTACTTCGCCAAGGAGAAGGCTGCCAAGAAGACCAAGGAGGAGCAGT
TCTTCGCCCAGTCGAGCGCCGTAAGTGCTTGTTTTCACTCTGTTGCTATCCCCTGCCGTTCCGTTGGTCGGTTTTTCGAGACCACTACAAACAGTTCGTC
CACATCCAGCAAGGAAGTTGTTCTGCAGTTGGAGAAAGAGATTGACGAACCCTTTGGGATCTCTCTCTATCTCTGGTTTCAGTGCTCTTTCTTGTGTGGC
GAATTGGGTAGGAGGCGTGGATGTCTTAGACGTCCATAGCTTCTTATCACATCATATGAGCGCTTGGGATCGCTTGCTTCGGCACATAAGCTCCCTATAA
GACACTGACCATGTTGGTGTTATTTCTCTCAGGCCCCCGTCATCTCGGAGCAGCGCAAGAAGGACCAGAAGGCCATCGACTCGGCTTTGATCAAGAAGCT
CGACGCCGAGCCGTTCCTGAAGGCTTACCTGAACGCCAAGTTCTCGCTGACTAAGAACGACCGCGCCCACGCCCTCAAGTTCTAAGTGCGCTCTTGCTAT
CCTGTGTAGCAGTGTGATGTGCGATGATTGAGATAAGAACAGCAACCAATATACCTGATGAACTTATCACCAAACATAAGTGTTTGTGTTGCATTTACCC
TAGAATCTCATCGAGTAGATCTTGGAGTATTGTACTCGTCATTGAAGGTTGGACCATAACTTATTAACATGCCACACAAATGGCAATAGCTCTTCGAGTT
TTTATCCGATCAGATTAAGACGGCCACAACACTGTTCCTTAGTGCGTTGTACGTGCATTACAACTTTTACTTCGCTAGCAACATGTCTGGGTCAAACACC
AAGGCGCGAGAGCTGCCCCCATGTCCGAAGGGCTTTGCCGTACGGTGTTACGAGTTCATGACCATATCGAAGGAAGGAGGGCTCTTTAGGGGGAGGCGGG
CCCGAGACCTTGTAGCTGCGTGTATGAAGATTGCTCGTGGCACCGCTACGACCGTAATAGACGAATACAGAGCCGACAACATTACCAAGTTCGAGGTCGG
TGCACCATATTCGCGACGCCAGCACCTTATCAGGTGTATATCGTTAACCTGTGACATATGATACTGTCATCTCAAGGCAAGCAAGCGTGGCATGAAGTGA
GGACAAACTACCTCTGTAAATCGATGTTGGCTTAAATGATTTGAGCCCCTGGTTAAAATATCTATGGACGTTTTTTTACTACATTTGCACTTTCGCCTGT
AAATCCATGTGTATCGCCCCCTCCTCCAATCAGAAGTGCTCCTCAAGAGCAACCCGTTTCCCGCAACTCTGAAGCCTCAGGAGTGCGTTTGTAAAGCGAC
CCGTAGCGCAGTAACGGCTGCGATTCAGCCGATTTTGACCTCATTTTTGAAATCTAGACCCAACTTTGCACCCTATATCTAAATGTCGCTATAGGTTTTA
GGGCTGTGAATCTTCATAACCGATGGCTACATTTTGGTCCAACGACTTGTGACGAGTACAATAGGGTGTTCTCGCTTTTGCCTTCTTGTAATTCGTCGTC
GTCGCTGTTTTCTTCCGACGAGCATTTCCTTGTCGAATAAAGACCGGTGCTCTCACTGTTGCCTTCATTTACAAGCGTGTTGTAGCTAGAGCTCTTTTTC
ACCCTGAGCGAACCACCGCTGGTCTGAATGGAACCAGTGCATTTTGCATCTGCTATCTCGCCACGAGCACTGACAAGCGAAGAGCCCCATTCTTGGTGCC
GTGCGTGTGCTTGGTATCGCTCTTTGGCTGTCCACTCTCGTCGCGATGACATGGCACCGCCACCAGCCCAATGACTAGCAGGCTCCACAGCAGATACCGG
AATTTCCTCCGACTTTTTCGAGCACACACTTGTCCTTCCAGCATAGCTAGAGTAGCCTCCTATAGTTTTGTGGTCGCTCCGTAGCGGCAACACGGGCACT
TCTTCCTCGTGCAGCACTAAAGTAGGCACCGCAAGCGTTGGCCGTGCCAATGGCTGGTCGAAAAAGCGGTGTTGAAGGGCTTGCGCCGCTGTGAGACGTC
GACTCGGGTCAAATTGCAGTAGGTCTTGGACAAGTTGAACCGCTGTGGATGGTGTGCCGGGCGGTAGAAATCGAGTCCAGGACACAGGAGAGCACTTGGG
GAAACGCATCTGCATATGAGAAGACATCGCTGCACCTTCAGGCCACGTCTCCTTGGTCGGTGTTCCTAAAACCTTGCAGATGCGGTAGAACTGGTCAGCC
TCTGACGTCCCTGGGAAGAGCGGCGTACAAACCAGCAGCTCGACCATGATGCATCCGCAGGCCCACATATCAACGGGGCTGTTGTACGTTGTTGAGCGCA
GTAAGAGCTCTGGCGCGCGGTACCATCGCGTAGCCACGTAGTCTGTAAACGGCGGTCGCGATCGAATTTCGCGTGCTTGGCCCAAGTCAGCGATCTTGAG
TGTATCATTGTGACACAACAGGTTCTCAGGCTTGATGTCGCGATGGAAGAATCCGTGCTTGTGCATGTATGCTAGGCCACTGAAGAGCTGGTACATCATC
GAACGGATCTGTGCCTCTGAGAACCATGGATGCGGGGGCACCGAAGATCGAGATGAACTGGTAGCATCAGAATTTAAGCTTGGATCGCCTCCAGCACCAC
TTGAGCTGGAACTTCCGAGAGTTTTGAAGTTGCGCATGACCCGAAAAAGTGACGTCTGCATGTACTCGAACACGAAGTAGAGCTCCTCCTTGTCTCGAAT
GACCTCTTTTAGAAGCACGATGTTTTCATGGCGAAGCACGCGCAGCGACTTCAATTCGCGTAGCTGGAGACACTCCTCCCACGTGGGGAACAACGCCTTG
ATCTTCTTTACAGCGACTATTTCATGGGTCTTGACGCTACGCGCACGCGACACTTCCCCGAAAGCGCCGTCACCAACTCGGTCCAGCATTTCATAGCGGT
TCATCTTGGACCTGCTCCTCAACCCCAGCAATGTGAATAGTAAGGCACCCTCTGCACCTATAAACAAACACAAACCAGTAACGATAATTGCTAGAAAGGT
CAAAATCCTTTCGTGTTGCTGACGCGGCTTACACTGGTTCTATGATGATTTGGTGAGCTTGCCGTAGCTTTCGATCATCCAGCGGAGTGTGCGTGCTACC
GTATCAATGTCGACTTTGTGGAGCGCACTGTGTAAACAAGACAAATCATGGTTAGATTTCCGTTGAAGAAGTAGAGAAGTATGAAGGCGGGCGCAGTTAT
ACCTGACAGGGAGTACAGCTAGATCGGTGGTCTGGCGCAGCTTGTTGAAGTTTTCTTCCGCGCCTGCATGATGCCAGAACAACGTCAGAGTGAGGGTGCT
AAGCACTCACAGTAAATGTTCCTCCCGTACCTTGCTCATCCATCTTGTTGGCAACTATCAGGGACGGACGCGACGAGATTCCTGGAGCATACAGCTCCAG
CTCTCTTTGAAGATGAGTGAAGTCCTCGAGGGGATCACGTCCCTCCGAGCCCGCCGTGTCAAGCACATACATTAAAATCTGTAAAAACACCGCACACACA
CCATGGTTAGCTCATCGCCCAGGTAGAGGAGACAGATCAATGATACACACACACCTTTGTGCGCTCGATGTGGCGCAAGAAATCGTGACCAAGACCAACA
TTGCGGTGTGCACCGTCAATAAGTCCAGGGATGTCAGCCACACTCAAGCGGAACGTGTCTGGGAACTCCACAATTCCCACGTATGGGTGAAGCGTCGTAA
AAGGATAAGGTGCAATCTCAGGCGTCGCACGGCTGAGAACGCTCAACAGCGTCGACTTGCCCGCATTCGGGTAGCCTACAAGACCCACATCAGCGATGGT
CTTGAGTTCCAGCTCGTAGTATTGCGAGGTACCCGGGTGACCCGTCGTCTTGTTCTCCGGCATGTGCTTGCGCAGCCGTCCGAATTTGGTCGTCTTGCCT
GCCAGGATGCGGTTACCCAGTCCAGGCTTTCCGCCCTTCGCAGCAAGGAACGTCGCTCCAGGCTCGTCTAGATCACACACCACTTCCATCTGGTCCACAA
TCTCGTACTCGCCATTCTCCAGTTCGCGCTCGTAGCGCTCCACGCGCTTGACGAGTGTACCACACGGCACCTTGACGTGGCAATGCTTGCCTCTCCTTCC
AGCAGAATCATTTGCTGGACGCCAGCCACGCAAGAGTCAGTACCCTGAAAAAGTATTTGCAGCACACAAATGAATCCCATGCACGTACCCATGCCGTTGG
TGCCGGCGCCTCCCCTAAAGTGGTGCGTGGCGTTCGCCAAGTTCTGCATCTTGTCGGAGGCTTCGATCAGGACGTCTCCTCCAGCACCGCCGTGTCCGCC
ATTTGGTCGCTTGCGCATGGCCGACTCGGCGAAGAAACTGGCGCAGCCATTGCCTCCGTGGCCGCCCGTGGCCTTGACGCGGATGCGGTCCACGAAGCGG
CGCTTGGAGTGCTGCGCGCGTCGCACGCGCACCTTCTGCTTGACGTGCTCCTCGACCTTGCGACG