Description :
From Genome Similarity Track
Location :
Scaffold_48:44228- 45515
Sequence
1287 bases(100 bases per row)
ACTGCGCGTACTGCACCGCCATGATTGCAGCCGATGGGACGGAATTCCTCAATGCATGGTGACGGTACCCAACTCGAAGGGAGAGATTCCTCGGCTAGGC
GTACGCTTCCTGTCAAGTGCAAGCTTCCCATAAGGTTCCAATATAACGAAGGGTGACTACAATCCGCCGCAAGCTCATCTGCTGGCCGCAAGCCGGATGT
GCAGAGACGGTCCGGACACAGGTAAGGATGCATCTGCAATGTCGTTTGTGCTGCGTGTACGGGAGCTGGAGTGCGTCACGTTTCGGACGACACCAGCCGT
GCTGATGGCCATCTTCAATCATGCATTTCAAGGAGAGTAGTGATATGTCATGTCACGAAGACGGCTCAGCGAACAAGAACTTCTCAAGCGACTTCATCCC
TTTAGCGGGATTACCTACCATTGGTGTGGAGTGCGGTTCGTACGAAGACACCCTTGACGCCATCCACGGACTCAACTCGCTTGACCAAGATGTTTGGTAT
GACTGCATGCACAAGCTAACGAGCCGACTGCGAGTCTTCGTATCGAAGAACAAGTCACCCAACCCGGAATTAACGGCGGTGCGTGTGCGGCTTACTCTCC
TGTACGGGAACAAGTTCTTGGGCGCCGCACTGGCTCATATGCAGGACGACGATGGTCGGGTTTCTGTGAAGCGTTGTGGGCGATCAATTATCGATCCCCG
GGATGGACAATGGCGCTCGTAAGCGCTGTGGCTCAAGATAAGAAATGCCCTCGTGAGTAGCGGAGCAACTACAAGCGCGATCATGAGCAACCCTGCAATT
CCCATGCTATTCATCGTCTTACCGCATAATCGTAGTCGTAAGGGTCACTACAAATTTGGGAGGATGGTTATGCCATATGGTCAATGCCTTGTTTTATTTA
GATTGCGAGGTAATTTTATAAAAGTAAGCCTAAAAAGTTAAAAACGTTGTATCCAATAGCAGAACAACATCTACTCGGTATCACAGCTATTGTCACTCGC
CTCAATGTCGTCGTCCGAATCTATATTTGCGCTAACAAGTTTTAGTCCAAGCAGCTTCTTCACAGTATATTCTGTGTCGCAGGAATGTGTATCGTCGTCT
TCGACGACACGTGTATCCATCAATAACCCCACCTTGACACTGTATCCAGCCTTCGGCCCACGACCATCGATGCTCGCCCCGTCATCTTGAAGCAAACTAA
ATACCGGTTACATCAGAGCACGTCAGCGACGGGACCTGAATCGAGAAGTTCGAGCGGCTGAGCTCACGGGAATTATGGCCAGACTAG