Description :
From Genome Similarity Track
Location :
contig_31:442263- 443291
Transcript NameFunction/comments
g7203.t1OWY98956.1 hypothetical protein PHMEG_00030139, partial [Phytophthora megakarya

Sequence
1028 bases(100 bases per row)
GGCGGACCACGGGCGACTGCAGTCCGGACGGACCTCGCCAACCTGACAAAGACCGGGGCTGCTTGGAGAAGGTGTCGATGGGCGAATCAGGCTACTGTGA
GGTGGAAGACGCAGTATCGGGCGAGCGATTCCGAGTAATGCAGAGACACTGCAACTCCATCCGACAGGGGGTACCATTTCGCTGTTCGGACGCTCAAAAC
TTTATCGATTTTCGTGTCCAAATGTACAGCAAGATTAACGAAGCGCTCGCACCCAATTTTACTCTGCCGAATGTCGTCAAAACGGAACCTGCACCTCGTG
ATGGCATCGTTATGGTAGTCTACCCTAAGTTACTCGCGAGTGCGTACGCTACCATTCGAGTCTTGCGGGATGTCTTGGGGTGTCGGTTACCTATCGAGAT
TTGGTTCCGACCGGATGAAGTGAAGCTGAACGATGGAATGCTCGCACCACTGCGGCACCTAGCTTCGACAGAGTCCAATATCACGTTCCAAGAGATCAGC
GACCCGCAATCGAAACGATTTTTCGCGAAAGTGCACGCCATTTACCACAGTTTCTTCGATCGCGTACTCTTTCTGGATGCCGACAATGTCCCCGTGCGAG
ATCCTAGTTTCTTGTTTGAGTCTCCTGAGTTTATCAAGACTGGTGCGATTTTCTGGCCTGATTTCTGGCACCCACGCTCCACACTGTTCAACATTCATGC
CAAGTCGTTGCTGTGGGAATTGCTAGACATGGAGTCCGTCGACATGTTTGAGCAGGAAAGCGGCCAACTCGTTGTTGATCGCCGACGACATGCGGCTCCG
CTGGAGCTCGTGCAGTTTTTCGCCTTTCACCGACCAGACTTTTTCTCCTTGCTGAAGCTTGCGTGGGGAGACAAAGATTTATTCCGTTTCGCGTGGCTAA
AGCTTGACGTTCCCTTTTTCATGGTCCAGACGCCGCCCGGCATGGCTGGAATGGTCATCAATGGCTCGGAGTTCTGCGGTATGACAATGGTTCAGCACGA
CGCGGACGGAGAAGTGCTCTTCTTGCAC