Description :
From Genome Similarity Track
Location :
contig_11:442246- 444663
Transcript NameFunction/comments
g3114.t1ETK93607.1 hypothetical protein L915_03244 [Phytophthora parasitica
g3115.t1hypothetical protein

Sequence
2417 bases(100 bases per row)
CCGTGAAGCCTTTAGTTCCAGCGAAGATTTTCGTTGTCACGACCAGGTCCTCACGAGTCCACACTCCGTCTTCGACACCTTTCTTGATGGCGAGGCCCAT
GATCTCCTCCGAATGTCCATCGGCGTAGTTTTCGGCGTTGTCGAAGAGGTTGATACCGTGCTTGAAGGCAGTCTTCATCATCTTGTACCAATTGTCGGGC
GTGCACTTCGGATCGGTGGCATCGTAGAACATCCACGAGCCGAGCGAGAGCTTGGAGACCAGCAGCCCCGAGTTACCGAGAAAGCGGTACGTCATCTTGG
TGTCGGCCATCGTGGCTTGGCGGATCTTAAAAGGACTGAAGTGTTCGGGGATCTGCTTGAGACCGAGTAAACAGAAGAATGAGCTGTACACTACTGAGGC
TCACGCAGTACATGCATTCTGAGTTGAGTAACTGCCGCACAACCAGAGACGATTGTGCGCCTGAAATGATCAGCCTGGACCACCGGCGCATAATCTTCGT
GATTGTGCGGCAAGCAGCTCACACGGATGCGCGCCAGCTTCAAGCTCGTTGGCATTGCTCAGTCTTCAATCGGCTGCTTCTCGCGCAGAACCCAGGCACC
ATGGCTCCCAACTCTTCGACCAAGATGACGTACCGCTTCCTCGGCGATTCCGGACTTCTTGTCTCCAAGCTCGCGCTCGGCTCCTGGATGCAATACAGTC
CGGAGCAGACGCCGGATGCATGGTACAAGATGATGCTACTGGCGTTCCAGCACGGAGTCAACTTCTTCGACAACGCTGAGATCTACGGCAACGGCCAAGC
GGAGGAAAACATGGGCGCCGCCATCAAGAGAGGCATCGCTGATGGTGTCTGGAGCCGTGAGGACTTGGTGATCACCACGAAGCTTTTAAGCGGCCACAAG
GGCTACGAAACTCGGGCCCAAACGACCAAGGATTGAGCCGCAAGCACATCGTGGAGGGCATCAAGTCGTCTCTAGCCCGCCTACAACTCGACTACGTCGA
TGTGGTGTTTTGTCACCGCCAGGAGCCCTACACGCCCATCGAAGAAACCGTCCGCGCCATGAGCTACCTCATTGAGCAAGGCTGGGCCTTCTACTGGGGA
ACCAGCGAGTGGCTGGCTGCTGATTTCCAAGAGCCTGCGAGATCGCCGACCGTCTCGGTCTCATCCGCCCCATTGTCGAACAACCGCAGTACAACATCTT
TGAGCGCAACAAAGTGGACTATGAATATGTCGACCTGTACAAGAAGTACAAGCTGGGCCTCACGATTTGGTCGCCGTTGGCGTTCGGCACGCTGACGGGC
AAGTACACCAGCAATGTGCCAGCCGGCTCGCGCTTCACGACGCCGAGGTTCAAGGAAGGACCTCTTTCCGTAGGCTTCACTGAGCACGTCGCGATGGCCG
ACAAACTCAAGCCGATTGCGACTGAGCTGGATTGCACGCTTGCACAGCTCGCGACAGCGTGGTGTGTCGCGAACGAGAACGTATCGACTGTCCTTGTTGG
TGCCAGTCGCCCGGAACAACTGAGGAGAACCTGGCGGCCTTGGACTTCGTGAACAAGGTGACACCTGACGTGAAGGCCAAGATCGACGCTATCGTCAACT
TCGTGCCCAAGCTCCCAGTGATCGACCAGTTCTGCTTCAGTCGCAAGCAATTCTTGTAGGAAGTGCACCGCTCAATTTAGTGCAAGCTCAAGTAAGCTTT
GGGACGGAAGTCTATTCCATTCAAACGTATTGAACGACCCATGAACGGTGCTTGGTATTATGTTGTGGCCGTCGGGCGCAGTACTGGTGTCTTCACAGGC
TGTAGGCAACAGGTTGATGGTTTCTCTGGCCGCATGTGGAACAAGTTCAGGTGAAACGTCAAGTACAGGAATATCCAAGGACGTTGTTGCAAGCAGCAAA
CTCTTCTCGAAGTTCCTCAGCGACACGCGGTTGGTGTTCACCGAGGACAATACTCAACACCGCAGTCTCAACAACTTCCACTTCATCAATTAGCTATGTC
TGAAAAGGCTCGTGAGGTTCCGACACCAACAAAATGGTGCATCTGAGTACTACTTGCCAACACTGCGTCAAAGGGGTCGACAAGCCCAAGTCTCGGGATT
TGCGGCGTTCGCTCAAGCGGAAGGCTTTCTAGGCAGACTCAGCATGAAGGTGAATCCACAAGGTCAAATGAGCACGGGTCAACTTCCTTGACAACTCGGA
AAACTGCGTTGATAAGTAGTGGGTGGGTGCCAAGGAACGCCTGGACTTGGAGCACGTTCACCATTCCCGCTGATTGAAGAGACCATACACTTCGTGATCC
AGCAGGGCGTTATACTGGGGTGCTGGCGAGTGCCTTGCTTCCGACACCAGGAGGCTTGCGAATCGCTGCTTTGGCTTGGTCCGTCCTACCGTCGAACACC
CGCAGTGCAAGATGCTC