Description :
From Genome Similarity Track
Location :
contig_31:442237- 443265
Transcript NameFunction/comments
g7544.t1hypothetical protein

Sequence
1028 bases(100 bases per row)
GGCGGACCACGGGCGACTGCAGTCCGGACGGACCTCGCCAACCTGACAAAGACCGGGGCTGCTTGGAGAAGGTGTCGATGGGCGAATCAGGCTACTGTGA
GGTGGAAGACGCAGTATCGGGCGAGCGATTCCGAGTAATGCAGAGACACTGCAACTCCATCCGACAGGGGGTACCATTTCGCTGTTCGGACGCTCAAAAC
TTTATCGATTTTCGTGTCCAAATGTACAGCAAGATTAACGAAGCGCTCGCACCCAATTTTACTCTGCCGAATGTCGTCAAAACGGAACCTGCACCTCGTG
ATGGCATCGTTATGGTAGTCTACCCTAAGTTACTCGCGAGTGCGTACGCTACCATTCGAGTCTTGCGGGATGTCTTGGGGTGTCGGTTACCTATCGAGAT
TTGGTTCCGACCGGATGAAGTGAAGCTGAACGATGGAATGCTCGCACCACTGCGGCACCTAGCTTCGACAGAGTCCAATATCACGTTCCAAGAGATCAGC
GACCCGCAATCGAAACGATTTTTCGCGAAAGTGCACGCCATTTACCACAGTTTCTTCGATCGCGTACTCTTTCTGGATGCCGACAATGTCCCCGTGCGAG
ATCCTAGTTTCTTGTTTGAGTCTCCTGAGTTTATCAAGACTGGTGCGATTTTCTGGCCTGATTTCTGGCACCCACGCTCCACACTGTTCAACATTCATGC
CAAGTCGTTGCTGTGGGAATTGCTAGACATGGAGTCCGTCGACATGTTTGAGCAGGAAAGCGGCCAACTCGTTGTTGATCGCCGACGACATGCGGCTCCG
CTGGAGCTCGTGCAGTTTTTCGCCTTTCACCGACCAGACTTTTTCTCCTTGCTGAAGCTTGCGTGGGGAGACAAAGATTTATTCCGTTTCGCGTGGCTAA
AGCTTGACGTTCCCTTTTTCATGGTCCAGACGCCGCCCGGCATGGCTGGAATGGTCATCAATGGCTCGGAGTTCTGCGGTATGACAATGGTTCAGCACGA
CGCGGACGGAGAAGTGCTCTTCTTGCAC