Description :
From Genome Similarity Track
Location :
Scaffold_123:44221- 45750
Transcript NameFunction/comments
g9037.t1ETK92358.1 hypothetical protein L915_04266 [Phytophthora parasitica

Sequence
1529 bases(100 bases per row)
TTTGTATCTGCTTGGCGTGGACTTTGTGGCTGATTGTACTGAACGTCGCCCCTAACGAGACCGTGAACCGCGTCATGAACACGGAGACCTTCGACTACGG
GTCGTTCTGGCTCATGATTAAACCATCCGCAGCTTTGTCGGGAGTTACCACGTTTGGCCTCTCAGTCGTCGCTCTGGGATACCTCGCGGTTCTGATCAAG
ATGCTCGTTTCTCGTCGACTCGACTCGAAACGAGCCTACGTCATCAACAATTCCGGAAAGAGAGTTCATTTCGCTGGCAAGGTCGAGACGGTGCTCAATG
GCGCGGATGAAAAGCACAAAGGCGGGAAAATGGTTTCCACGGCGGTGAATTTTGCGGCTTCTCTGGCTCAAGAAGATAGCACGGCGAGGAAATACGTTGT
AAGTTCAATGTGGGCAATATGTTCTGGTGGGTATACTAATAATGCGATCGTCTGCAGAAACTCGGCTTGAAATTTGGAGACTTGGCGCTGGAAACAGTTC
TCCTCTATCAAATGCTCGAAGCTGGGTCACCTGCGCCACTGATCGGCGTCTTTACGGCGATCGTCGCGTCGAACGCCTTATCTTGTGCGGCTCTGATGTT
CGTCCCGTACGAGACAGCACCACTTGCGGAGACCCTCATCGACATTATGTACGTCGCACTTTTTCACTAGTGTCTTTCGAGTCTCTAACCTGATTTTTCA
ACCAGGTTTGACTTTCTCATCGGTGTGGGTTGCCCCATGCTCGTCCTTTCGTACTGCCTCTCCACGTTCACGTTCGATCGTGCCAAATTTGCCATCAACT
TGGCCGTTTTCCCTGCCGGGTGGTTTGAGCAGGGAGCTAGCGTTATCGCAGACCCCGTGGAGACCGCTGTGATCTACAAGAATCTCAAGTCTCTCCGGAT
CATGTCCGCGCTGGACTTTTTCACGCGTATGGGCATCAATTTGACTTTGTGCTACCGACTCCGCAACGTCGTGGAACTCATCAAGGACCCGAAAAAGCAG
CAGAGCAGCGTCTACCCGAAGCGCCATCGTCTGTCAGTGTGCGCTTTTGTGGGGTTCGCAGTGTTTTTGGTGGTGTTTGTCGAGGAGAGCATGCGGACGT
CTGATGTGGCATGCCACCCGCACCCGGAGTGCGTCGTAAAAGCACGGAGATGGACTAGCCTGAAGACGGACTCCTTAACCCAGTGTCCATGCATCATAAT
GATTGACCGAGACATTGCGCCTAAAACCTACGAGGAGTGGGAGAACCCAACCAACGTGACCGACAAAGTGGCCCAACTTGCTGCGATGGGAGATCTTCAG
ACAATTCAGTTGACGAACCGCTACATTCCAGTTTTTCCGGACGAACTGCGTCGCTGCACGAACTTGAGGCATCTGTATGAGGCTATTTAGTTCCTGGCTT
CTGTTTGGTTTGACCGCTAAGCTGACATTTCTTTTGGCTGCACTCTTTACCCAGGTCACTGGAGTACACTCACACGCAAACATTTCCCGACTGGGTTAGC
GAGTTTAAGAAACTCGAGTTCTTGTACGT