Description :
From Genome Similarity Track
Location :
Scaffold_238:44220- 45324
Sequence
1104 bases(100 bases per row)
AGAGGTTTCGTCATAAAATTTACTTGGTTCTGGGGACCAAATGTTGCGTTACACGGTAGTGGCCTTTGTTAAGGGAACATTATGATTGCAAAGTAAGCGT
CAGGTATGTTGCGTGAGGGTGATTTGAGCACTTAACGCCGACTCTCTGGATTAATAAAGCCAATAATAAATGGCGGCACTGTGTATGCTTATATTTAGCT
TAATGCAGCCACTATTTTAGCAAAGGCGACGATATCAAGAAACTGTTATTTCGAGCAATGTCATTGGGATGCATTATGGACACTGCACTCGTCTTAGTCG
ATGGTTATATTAAATTGCTCATGCGAGCGAGAGATATTCCCTCATAGCAGTTAGCACACCAAACGAAATGCTCTGAAAATAGCTGCTTATGCTTCAGGAG
CTGTGCAATTCTTCAGCTACGTTTAATTGTCGTTTCAGCAAGTGTTCTGCCTTCATGTAGCTTATGCCCAAGATACTTTGATGTCACCTTTTTTCGAAGT
CGTTTGTTACAAGGGAACTAAGGTGTGGAAAAGCACATAGGCAATATACGACAGATGATTGATTACATGCACACGAACTTGCTGTACGATTATTTTGCGT
CAAATGGCTTAGTCCTGTCAATAATTTACACAAATACAGTGGGAACTACGCTGGTATGGCTTGACCGTTGTCCGATATCTTTTAGAAAAATGTATAGTGG
TATTGGATGACCAAATATGATAAATTTTAGCAAAGCATGGAAGGGTAGCCTTCTCCACGTCCCAGTTTTGGCTCTGATTTCTTCTGGTCGGCGTTTAGTG
TCGTCTGTGCTGCATCCTATTTTGACATTGGAAGTGTAATGTTAAAAACGTCCTTTGATGTGCAAGAGCGATCCATCGCATCTGAAGTCACCAGCTGTAA
ATTACTTCCTATGTCATGACAACAAGCTACTTGCTATATAGTATACGCTTGTAAAATTCATATTTTATGTGCTTGGCTCTAATCCGTTTGTGGTCTCTAT
CGACCATGCAATATTCTCACTGCCACTCATCTGCCTTATATCTCGCATAAAATGGTCCGATGGCTTTCGTTTTTTATGGATATAGCTTCGAGGTGAGCAA
AAAC