Description :
From Genome Similarity Track
Location :
Scaffold_21:44218- 52423
Transcript NameFunction/comments
Physo_132448reverse transcriptase
Physo_132449hypothetical protein

Sequence
8205 bases(100 bases per row)
ACCTTGGTGTAGACACACCAAAGGCTACATACATTTACGACCACCACGACGGGTGGTCCATACAGACTTAGGATTCCTATTGGCTGAGAGCAGCATCTCT
TAGCCAATGAGCGACATGCATAGCATTGGAATTCTGCCAACCAGCCGTTGGCAGATTCCTATCTTAGAATATTACATTTAGAGGAAGTCAGGAACATAAA
ACAAAAATAGCAGTTCTCATTTTAACCCAAAAACATTATTTGGATCGTTTATTTAGATTAATCTATACTCGGAGGCCCGAGTATAATTAACTCTAAGTTA
AACTAAGCTACGCTTCCTCACATACACGCGCACACGTGTCAGCTAAAGTAGTGAGCCGAAGTAGGCCCATTACACCTGGTAGCACTTTGTAGCCCGTCCA
ACGACCGACTATCTGAGCTCGTACGTCACCGCACGAACGCGGAGCAGAGAACGTTCCCATGGATACGGAGGTGGCCATGGAAAGCTCCACTACGCCTGCA
ACTCACGTTACATGCGCTGACTGTCCCCACCTGTCGGACCCAGAGTGGGAAGCTCTCCAACGACTGTCAACAGTCATTGGTGAGGCGGCTGTAGCTACGA
TGCTGCGTACGCTAACGCCGACAGAGGAACATGGCGTTGCTCTGGGATTCATCATGAGGGAGCAGCGAGATGCAGCTTCGTCTGCCACGGTGTCGTCGGA
GACGACACCGCGCGCGCAATCGCTGAAGCTCAGCGTGAGCAATTACGTTGGAAGAGAGGGCGAGCCTCTCCTCCGTTGGCTTGTCGAACTCGACACTTCC
ATTGCGGCTCGACGCATCGTCGACCCGTTGTCGAAGGTCGCGTTCGCCATGTCATGTCTTGGCGGACGTGCAAGAAGTTGGGCGTATGGACGCCGACTCT
CAGATCCTACGTGCTTTAGCACGTACGAGGGTTTCAAGGAAGAGCTCAGACAAGCGTTGGAGCCCCCGCAAAACGAGTTCCGGTCGAGGGCGGAGTTTCT
CGACCTGCAGCAGGGCAAGCATGATGTCCATGCTTACGCTCAGAGAGCACGGTACTTGGTCTCGAACATCGTGACCAATCCGATCGACGAGGCGACCAAG
GTCGTCACGTTCATGAAGAGACTGAGAGATGGGCCTGTGAAGACCTATCTCTTCCGTGAGTACCCGAGTACTCTCGAAGCTGTAATCACTCTTGCAATGC
AGGAGGAGTTTAGCCTGCGGCAGGCTAAGCTGCATGAACATGCGCCGAGGCCACAGCCTCGCCCGATAGTGAGGACGGGAGGCCCAGAACCCATGGACCT
CTCGAGCGCTGCAACTGCTGGACCCCAGCAGTCGCAACGAAACAATGTGCGATGCTACCGATGCGGTAGAATCGGTCACTTTGCTCGGGAGTGCACGGCC
CCCGTGCACCAGCAGGGTGGCTATCGCGGCGGTGCCAGGCACCGTCGCAACCAAACAAAAAGCGCTGGACGCCGGTAGGCGCGGGGCGCCCTACTGGTAA
TGCAGTTCCGCGTGTCGACCTTGGACACGCGACACTGAGGACTGTAGCCCCGAGTGAGATTCATTCTCACTGCAAGAACCAAGATGACAAGCATGACCTT
GTCATCCTGAACGTGAACTCGATGAGAGCAAGCGGCTCTCTCCGTGCTTTGGTAGATTCTGGCGCGTCGAAGAACTTTGTTCGACTGCGAAGTTTATCAG
GGCTTGACTTCGAGGATTTAAAGATACCTCGAAGTATGCTGGAAGTACGACTGGCAATGGGTGCCATCGTAAAGACCGAGAAGCGTATGGTACGCGTGCG
CTTCACGTATGAAGATCAAGAGTTTGTCGAGACCTTTATCGTCCTGGATCTGGACGATAAGTTTGACATGGTATTGGGCATGCCGTGGCTTGCACGGTAT
GATCCGGTCATCGATTGGGAGAAGCGCACTCTCGTGCGCTTCGGTCGCGACAGCGGAACAGTGAGCGATGGCCCTGTTGCTGCTACGCACGCACCGACAG
GTGCGCCCGACTCCCCACTCGAGACAGCGCCTAATGCCGCCGTCCCGGAGCGCCCTGGGCGCGCGCGAGCACGCGCGCAAGAGCAGCAAGCGTCGGCGTC
GCCGCCGACGGCTGAAGGAGAAAATGTGTTGATCTCGGAGATCGACACCCGCTTTTCAGCGAATCAGGAAGAGTCTCCGACCTCAAGGGGTACGGATGAC
ACAGGCGAGTCACACGCCTCAGCCGTGGGGGCTGACGCGAATCTGATTGGATCAGTTTTGGCCAATAACAGGAGCCAAGGTGACGAAACGCCGTCGACTC
CGGGAGTCGATGGCTCGGACGAATTTGTTTCGTCGGCTCGGGGAGCCGACGCACCCTCCGTAATGGGGGTCTCCGCCAATGGTTGGCGTCGAGGTATCGA
AGCCGCATCGACTCCGGGAGTCGATAGCATGGACAAATTTGATTCGTCGGCTAGGGGGGCCGATGCACCCTCCGTAATGGAGGGCTCCGCCAATAACAGG
CGTCGAGGTAAAGATGGCGTGTCGGCTCCGGGAGCCGACGCTGCAGGCGGTGCGGACGGTTGCAAACGTCCCGCACAGGAAAACTTGCATGCTGCCGTGC
AGCCGGGCTGCACGACGAAGCGCCGGGCGACCAAGCCGGACTTGAAGTCGCTCGCCCGCGGGATGAACCCGCCGGCGGTACTAAAGAAGAACACCCGTCC
ACGGCTGGGCCTGGACGAGGTCAAGAACCGAGCGGAGCCGGGCTCCGCAAAACAAGAAGACGGCGTATGCGAAGATCGCTGCGCAAGTCTCGGCCTGGGG
CCGAGACGCTACAAGGAATGTCTGCCGGGCAGACGGAGGCTGAGAAGCCGGACGTGGAGACGTTAAACGTCTTGACGCGTACCTGTGCCGGGTTCCGGTA
CAGGGAGATAACTCTCGCTAACCCTCCGACGCAAGCGTCGGAGTTGACTTCGCTTCCAGTCATGAGCTGGAAGCGCTTCGCGCGTGACTTGCACGATGGA
CGCATCGAGCAAATATGCATTCTCTCGGACGCCGAAAGAACGAAGAGCGAGAATGAAGAACTGAGGCAGTTCTTCATGGAGACCACCACTGAGAGCGAGG
ACACTCTCAGTGCGAAGACGAAGAAGGAGCGCTTTGAAGAGCAGAGCTGGGACTCGTTGAAAACGAGTCCCTACTACGAGATCTTACGGGAGTACGCGGA
CGTACTTCCGGAAGCGATTCCTGCGGAGCTTCCGCAGGATAAGAGCATCCAGCACGAGATTGATCTCGTGCCGGGGACGAAGTACTGTGTCACGCGGCAG
TGGCCACTACCGCGAGAGCAGGTCAAGGCGATCGACGACTTTTTTGAGAGTCGTCGCAAAGCTGGACAAGTGCGGGAATCGAAATCCCCGCACAGTGCTC
CGACGTTCCGTGTCAAGAAGCCACAGGGCGGCTGGTGCATCGTTCATGCGTACAACAAGCTGAACGATGCGACGATACCGGCACAGACACCGATACCGCG
AAAAGATGTCATCATCGATTCGATGGCCAGGAGCACTATCTACAGTGCTCTTGATCTGCGCGATGGGTTCTATCAGATCCTCATGCGTGAGAGCGACATC
CCTCTCACGGCTGTGAGCACGCCGAGCGGCATGCTCTGGGAGTGGCTAGTGATGCCGCAGGGTCTGAAGAACGCCTCTGCGACCTTCAACAGGTGCGTGA
CGCACTTGTTGCGCTCGGTCCGCGACTTCGCACCGAGCTACTTCGACGATGTGTTCGTCCACAGCCGGGCTGCGGACGGGATGAGCGATGTTGAGATGCA
CAAAGTGCATCTCTGGAAGCTGCTTGCGCTCATGCGCAAGCACAAGCTCTATGCGAACCTGAAGAAGTGCATCTTCGGGGCGAGCGAGATACCCGTGCTC
GGGTGTCTCGTTGGGAAGAACGGTGTCCGCCCTGACCCTGAGAAGATCAGAGTGATCAATGAGTGGCCGACGCCGTCGAACGTCAAGGAACTGCGGCAGT
TCCTTGGCTTGGCCACGTACTTGTGCAAGTACGTGAAGGACTACGCGGGCATGATACGCCCTCTGTCACAGCTACTGAAGAAGGACACCGAGTGGGTTTG
GACTGCTGAGTGTCAGCAGGCCTTTGATGCAGTCAAGCGGGGCATGACTGAGGCGCCGATCTTGGCGGTGGCCGACCAAGATCGCCCATTCCACGTTGTG
TGTGTCGCATCCGACTTCGCAATCGGATGTGTGTTGATGCAGCACGATCACGAGGGCCGTGATCGTTTCGTCTACTACCAATCGCGTCAGCTGAAGCCAG
CTGAGCGCAACTACCCGGTACTTGACAAGGAACTCCTTGCCATGAAGTACGCACTCGCGAAATTCCGAGTATATCTACTCGGAAGCAAACCGTTCGTGGT
CTATACGGACCACGCGTCGCTGCGGACGGCTGTGAAGTCGCCGCACATCTCGCAACAGATGGCGAGATGGCTCTCATTCTTCGCAGAGTATAACTTTCGG
GTTGAGTACAAACCCGGAAGACTCAATGTGGTGGCCGACGCGCTCTCGCGTCGACCTGACTACGCCACGACTGATGCCGACGTCAATGCCATTGACGCCA
TGCGATCGAGCACCCCGACGTCGTCACTGTTGGACGACGTGAAGGTCGCGTACGCGCACGACGCGGACGCGAAGCTCTTGCTAGCCTACGGCTCAGCGCC
TTCTGACAAAGCTCGTCCGAAGCTGCCGAAGCATCTTCGTGCTCGTGCACACCGTTATCGGGTGCACGACGGGTTACTACTCTACAGTGCAGTCGACGAC
AACACGGACCGCGTTGTCGTGCCCAATGACCATGACCTGCGACTCAGGATCATGTATGAGTATCACGATGCGTCGACTGCGGGGCATCCGGGCCGTGAGA
AGACATACCTTCTTCTCACGCGAGACTTCTACTGGGCTCACCAGTATAAATGGGTGCGCAAGTACGTCCGTGCTTGCGAGGTTTGGCAACGTTTGAAGCC
TGCGCCTTTCGCGCAGGCTCCCTTGCAGTCACTACCAATCCACGGGAGTGTTGGCAGTCCATGTCTTTGGACTTCGTGTTCGGTCTTCCCCCGGACAGCC
AGGGGAACATGGGTGTTGTGGTCTTTGTTGACCGCTTCAGCAAGATGGTACATCTTGCTGCGGTACCCGCTGAAGTGACTGCGAAACAGACGGCTCGTCT
GTTCGTTGACATGGTGTTCAAACACCATGGCATGCCGATCGACATTGTGTCGGATCGAGACCCGCGCTTCACTGCACACCTTTGGTAACAGTGTTTACAC
TTCTTGGGAGTCAACTTTCGATGTCGACTGCGGATCATCCGCAGACGGACTGGCAGACCGAGCGCGTGAACCGCGTGCTCGTAGACGTGCTTAAGAGCTA
CGCTCACTCGGCTCAACACTGGAGCGAGTGTCTGCCGATGGCGGAGTTCGCCATCAACAACTCGGTGCATGCCTCGACCGGGCATACACCGTTCTACGTG
AATGCCATCAGGCACCCACGCCTCCCGAGTCTACGCAGGATGGTGGCCCCTTCCTTAAGTGGGGGAGGATCTACGACTGCAACGCAGCAGCCGCAGAATA
CCGCTGACACTTGCACAGTGTCAGCCGCGACTACGCGCAAGAAGAACAAGAAGCACGCGTCTGTGCAGGGCACAGACGCTGACAAGAGCAAGAAAAAGAA
GAAGAACGGGTCTGTGCAGGGCACAGACACCGCGAAGACGAACGCAGAGGCCGGGCCTACTGCTAGAAACGAGCTGAACGAGTTCAGCTCGGACGCAATC
AACTTCGTGCAGCGCAGACAAGCCGTCATTCGGTTTGTCCAGGACGCTATTGCAGCTTCTGTCGACCGACAGAAGGTGAACGCAGACAATGTTGGTAGGG
GCAACACTAATGAATTCAAGAAGGGTTCATTGGTTTTGTTAGCAACTCAAAACCTGCCAAAACATACAGTTTTTGACTTCGGGGCGAGCAAGCTCGCTCC
GCGCTTCATCGGGCCGTTCACGGTGTTGGCACGGCATGGCAACGCCTACACGCTAGATATTCCATCTAGCATGCGCCTCCATCCGACCTTTTACGTCGGG
CGGCTGAAGCCATACCGGCAGCACGAGCCACCTAGCTCGGCTGGCTCGAAGCGGAAGCCCCAGCGGGAGCGAACCTCTGCTCCAGCGCGTGAACGCGCTG
GGCCAAGCGTGCGACGCGACCTCCCACGTCGACAGAGATGTCCGACGCGGTCTGCGAAGCCTGAGCGACTTGAGCCCTCAGGATCGCCACCTCCTGCTTC
AGAGCGGTGAACTCCCGGCTCTGATGCTGTTCCACAGCAGCGACCCGCTCCTCGAGCGTCGGGCCAAGGTCACCCCAGGTTGACCATACCCAGGGCGTGT
TCCCACCACCGCCGCCTCCGATCCGCGACGCCCGCGGCTCAACACGCTGGATTGTTGACCGTATTGTGAACCATAGTATCCCAAAACCGAACCGGCAGCC
GGTTCGTTATCGTATTCGTTGGAGAGGGTTTCCGCCCCACCAAGATACATGGACGTCCTGCTGCAGGACGTTCCGGAAATGGTGAGGGCGTACGAAACTC
ACCACGCACTGCCGACGCGAAGGTAGTGCGAGAGCTGTGGTCACCTACAGCGCCCGAGGTCCCACGATCGTCGCGTTCCTCGCGTGCCAAGAACTTGGCA
CGGAGATCCTTGAGACTCTCAGGTACACGAATCGTCGTGTACCCGTTTAGGTCGCGGTCGCTCAAGCGCACCGCACCCGGAAGACACAACGTGCACTGAT
GGCCTTCGGGCACAGCGCATGGAATACCAGCGTCCACAGAGGATCTGTGGAGCTGCTCCAACCTCCCGCGCGTCGAGAATGTCTCGAAGTGTTCACGGGC
GTGCTTAACCCGCTCACGGTAAGCAGCCGGCTTCTTGTTGAAGTTCTCAACAAAAGCATTCCAACTTTGACAAAGTGCCTGCCACTCAGGCACTTTGCTG
CGAGAAGAGGTCTTCTTGCTGGAGAAGTATCGGAGCTCGTGAAAGAGTCCGATATAGTAATCGCGCCTTGGATTCGTTAACGGATCGAAGTGCTGCTCCT
CCGCCACAGCATCGTCGTGGATACCGCTGCATACGTACAGCGGGATTTCGTTTGGAGGCACAGTGTTGCCCACACGGTCTGCGATCTCTGAGGCAGACGG
CATCCACGGATCGCGCGCTGCCTGAGCAGCGCGCGGAGAGCTTGAAGGCGCCACCTCACGCGGAGAGCTTAAAGCCCCAGCAGCAGAGAGCGGAGTGTCG
CTCTCGCCGCGCGAACGCTTTGAGCTCGAAGCGTCCGAGTCGTCTCCTTCACGAGGGCGTCTCGACCCGGCATGCGGGTCGAGACTATCGCTGTCGATAG
ACTCCATGCGCTTGCTAGAAGAGGCCTCGCCCTCTTCCATCTCCACGTCGCCGTCCTCGAAGTCAACGGCGTCGTTGACTACAGAAGAACCTTCGAGGAC
AATCTCTGGTTGAGTTGTCCCCGACGCGGCCTTTGCAGCGAGCGCGTCGCGCTTTACCTGCTGGCGCTCATGGTACTGAGCAACAGAGAGGTTACCCTCT
GTTGCGGCGGCGGTCTTCTTCTGCGGCGAGCTCATTGCGGAATGAGCTCGATTTTTCTTTCTCCCAACGTGAAGAATTGACGAATGGTCAATTTCCTGAT
TGACGTGCCGTGACTCGGCGCGTCTAACCTTAAGGGGGGGATGGTGTAACAGGATTACACGCACAAGTGGCTACAGTCACTTGTAACTCTAACAGATACG
ACGTCTGTTAGAGGTTCGAAAGACTTTCTCGACCTTGGTGTAGACACACCAAAGGCTACATACATTTACGACCACCACGACGGGTGGTCCATAGAGACTT
ATGATTCCTATTGGCTGAGAGCAGTATATCTTAGCCAATGAGCGACATGCATAGCATTGGAATTCTGCCAACGGCTGGTTGGCAGATTCCTATCTTAGAA
TATTACATTTTAAGGAAGTCAGGAACATAAAACAAAAATAGCAGTTCTCATTTTAACCCAAAAACATTATTTGGATCGTTTATTTAGATTAATCTATACT
CGGAGGCCCGAGTATAATTAACTCTAAGTTAAACTAAGCTACGCTTCCTCACATACACGCGCACACATGTAAGCTAAAGTAGTGAGCCAAAGTAGGCCCA
TTACA