Description :
From Genome Similarity Track
Location :
Scaffold_419:442165- 444455
Transcript NameFunction/comments
Aphin_H310_00980dynein heavy chain

Sequence
2290 bases(100 bases per row)
CAGGAAGATCATGCCCATGCGGGAAATCGTCGCGGGCGAAGCAAAGCGCAGATCGTTCGTCTCAAAAATAAAGTTGACGTTCGGTCCAAAGTTGATGCGT
TCGCCGTTGGGGAGCGTGAGCAAGTGGTTGTCGTCAAGGACAGAGTTGAGTGACTCGATCCACTCGGGATCGACGTCGCCGTCGCAAACGATCCACGACC
GCGTTGTTTCAGGCTCCTTAACTACCTTTCGCGCCGCATCTGTCAGCACACCATCGTGCCACTCGCGCGTGTCGAGGTCCATGTGGCCCAAGAGGCGCTC
GCGAGGCATCGACTTGGGATTCATCACGTACGTCTTGACCAACTGGCCGCACTGGACCATGGCCATTTGAAGGACCTGCCACACCGTGCTCTTTCCGCTT
CCCGACGGACCCACGACGACGCATCCCATGCGCTGGTCCAAGCTTTCCTTGAGCTGGAGCATCTTGCGAATTTGAATGTCGTCCACTTGGCAGCAAAACG
GCTTCTTCTCCATGACATCGCGAATGGCCGCTTCGAGATCGCCCCCAGAAATGTCGGCCGACTCAATGCCTGGAAACACGTCCCCAATGAGAGCGAGGAA
CCGTTGCGAATCGCCAAACGTTAACTTGGACAGCGTGTTGATGCGCACGGCCTTGATCAAGATCTCCGTTTCCTGTGCTCCTGTCATGCGACCTGACACT
TGCTTCTTGGCGAGCTGCAGCAGCTTCCCCGCGGTACTGAGCACCGCCTTCAGAGCCCGAAGGCCCCAATCGTAATGCTGCTGTGGCGTGAGGAGCTGTC
GGCTCAGTGTGTACAACGAAACGACCTTGGACGCAATGTCCTTGGCCTCACTGAACCCTTCCGACGACAGCACGACTTCAGCAATCAAGTTGTTGTCCGG
TCGGCCCATCGCTACCGGTCGAAAGAGCGCTTTCAAGTTGTCTGGCAACTTCGAGCGCCCGCCGTAGCCCTTCCCAGCCGGATTGAGTGTCACGAAAATG
CCGGCATTAAAGTCGACGTCGACGTGACGATGGAGCAGCGTGATCGACGTCACGTGGTTCTTTATGGCGTCTTGAATGAGCTGGATTTGCTGTGAGATGG
CACTGAGTTGATCCTCCTTGAGACGGTTAAACTCATCGAAGCACCCCCACGCACCGCACTTGACGAGCCCGATGAAAATGCGCCCCATGCTTTGGAAGTC
AATGCCTTCATCGCAGTTAAACACGAGCACCTGGCGACCGAACTGGCCCCCGAGCGCCTTCACGCTCTCCGTTTTGCCCGTCCCAGCAGGGCCGTACGGG
TTTCCACCAAAGCCCATGTGCATCCCCTGCGTCAGCGTTAAGTAGCACTTGTCCGTCAACGGTGTGTGGACGAGCTTCGGTGCATTGCCCTGGTACTCGT
ACGTGTAGTTGAACACGGCGTCGTTCATCTTGATCACGCACTGGTGCGACTTGTCTAGGTAAAACCGGAGCTGCTTTTGCCACTGCCAGTCCGTGAGCGA
TCGAGTGTTGACGAGTTGTTCGCACACGTCGATGTGGTGCACCAGGTCGAGCACGAGCGCTTTCACCTTGAGATGCATGAGCGGTTCTTGGCTCAGGTCC
AACGATGTCAGCTCGCGAAGCGTGTCTTGGAGCGTCGCCTTGAGTTCCGGCACTGTGCCATTCTTGATGGCGGCTTCGCATTGCGAATTGAATCGGATCT
GCTCCGCCAGACACAGCACTTGAGACGGATATTCAGCGTAGTCTGGGCTGGCCGAGTTTGTTGCTTTCACGACCAACAGCTTGAGCGTTTTGCGCATCTC
AGCGGTCAGCGCTTCGAGCCACTCTTCGACCGCGCTCGTGATGGTGACGGGCGAGTTCAGCGGGACCTTTTCCTGAGCGCTGCTGCACATGGCGACGATC
TGGTCCTTCTTTTCACTGAATTCGACGCGGTGGATGCCTTGGTACAGCTTCTTCAAATGCGTTTGAATGACCGCCGGGTTTTGCGACTGCCCAAGGATCT
CGAGCAAGTCTTCGTCCCCGATAAAGTAAAACCGGGGAAACCGGGACCGCTTTTCCTCCAAAAAGTCGGCGAGCGCCTTCTGGCATCGCTCCAGTTGGTC
CACCATCGTCGTCAAGCGATCCTGCAGCTGCGGGAACAACATGTCGTCCGCCAAGTTGAATAGCTTCGGGTCGGTCTCGACCGACCCCATGATGTCGCGA
AACTCGTCGTCCACTCGCTTGAACCGGGTCGCTTCCGACGGTAGCGCGCCCTTGCCAAAGATCGGCTCCAGGTACACCCACTTGCGCTGG