Description :
From Genome Similarity Track
Location :
Scaffold_3:44203- 45274
Transcript NameFunction/comments
Sapdi_VS20SDRG_01103hypothetical protein

Sequence
1071 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NGTTACCGTGGGCTCCACGGTCGCAGTCGAGGGCACCGGCGAAACAGGCGTCTCGGTAGTCGGCACTGGAGGCGTCTGCGTTGGCGTCACCGTGCTTGGC
GCTGGAGTCGTCGGAATCGTTGGCACAGGCGTGGGCACTGGCGTCGCCGTGGTCGGAATCGGCGCGTCGGTTGTAGGGCGAGGTGTTCCTGTCGTCGGTG
CTGGTGTTTGCGTCGTCGGTGCTGGTGTCTCTGTCGCAGGCGACGGCGTGTCGGTGCAAGGCACTACAGTGGGAACGATTGTTGGTAGCGGCGTCGCCGT
TGTAGGCGCGGGCGTCGGGGAAGGTGTTGCCGTGCACGGGCTGATCGGGATTGGAGTCTCGGTCGACGTGGGCCGTGTCGGGGCAGCGCACCGGTGCTCA
CGAAAGGCGCCGTCCGACTCGATAGTCCACTGCACCCAGCTGCCATCACCGATACTGGTAGCGTGCACCAT