Description :
From Genome Similarity Track
Location :
Scaffold_97:44202- 67618
Transcript NameFunction/comments
Phyke_g4234hypothetical protein
Phyke_g4235ATP-binding Cassette (ABC) Superfamily
Phyke_g4236hypothetical protein PHYSODRAFT_505814
Phyke_g4237putative endo-1,3-beta-glucanase
Phyke_g4238tryptophan synthase
Phyke_g4239hypothetical protein
Phyke_g4240DNA repair and recombination protein RAD54
Phyke_g4241hypothetical protein PHYSODRAFT_302440
Phyke_g4242hypothetical protein PHYSODRAFT_508492

Sequence
23416 bases(100 bases per row)
GCAGGTGTTTATATGTCATTGGAATCTAGGGCTTGGTCCTCAAGGCGGCGATTGTTCGGGTGAAATTGGGCATTGGAGAAGTCAGGGGATGACACGACCA
TGGGGAACTCGGCTGGGAAGCCGAACCCACCGTGAAGAGAAGGGGGCAGTGATTCCATGCCTGGAGAAGGCAACAACGCAGGACCGAATGACGCAGGGTG
ACCTGGGTTGAAGTAGTACCGTGATGGCGGAGGAATTGACGGCCCTGGCGGAGCGTGCAGGAAGCGCGACGCGTGAAATGTGGAATATGAATCGCCGTCT
CCAGGCGAAAAGTATCGCACCACTTCTTTCGGTGCCGTTCTCCATAGCGTTGAATCACTCCAGGGAAGATTCCCACTGGGTGGTGAGAGCTCTCGTTGAT
TTGAAAAATCCCAACCAAAGAGCGACGCTGTGGACGCGTacacttgctgcaactgccacTCGAGCtttgcgtcttcttcatatCGCCGCTGTTTCCTCCA
CCGCCGGTGATCATTGTCGCGATCACTCTCTTCTaaatcgtcatcaccatcagaCAATTCTCCATCAACACTTCTGCTCTCGAAAATGCTGCCCTCGTCA
CCAGCGACGTCTTCCAAAGGCACGCTGACAATGTACTCGTCAAACTTACGCTTTCCGGCGTAAGGGCTCCGCCCTTCAACAATTTCTGTTGCCGGTGCAA
TCTCCTGGGGCTGGAAAACCGATGCGTTTGGGTTTAAGCCTGATGGTCGCTTTGGGCGGGTCCTCACATCCTCTGAGAGCTGGAAGTCCGTGGTTGGGGC
GATGGATACGTATGAAGCATTCGTCTGACAACCATTGTCTAGAGTCATAATCATAGGCTCAGGCACAGGTTCATGGACTGGCTCCTCTATCGTGTCCTCC
GTGGCTACAGTTTGTATTGAAACCGATTTGTTTGTGTTCGTCTTGCCATCAGGATTCTCAGTCATCACATCACCCTTATCTTTCTTGTCGACTAGCTCGG
AAGAGTCGAGTTGCTCAACAGCTAAAACAACAGGTGCCACCGatcttctcttctttttcttcttgctcttctttttgttgttggaAATCGAGATGCCTGT
TGATGTATTATGCCCTGCAGCTCTGTCTTCTAGAGACACTTCCAGCAGTAGTTGCTCCATTTGCTGAGCCGCTTCTTTCTCCAAGTGATTGACATAACTT
TTTAAAATGAGCTAGACCAAACACGGCACATCAGTACAAGTACATCAAAACTACCTCCAAATCCGACAGAATGCACCATACCTGCTCGACCAACATTGCG
ATCAGGCGCTGGTAATTTGCCCATGTATTGATGGTCTCGCTTTCTGCCACGAAGAGTTTGTTGAAGTTACTCTCCGTAAGCACATTAATGGACGTCAAAA
ATCCAGACAACACGTCTCCCACAAGCGAAAACAATCGATCAGTGTCTTCAGccagctccgtcttcacTGTTAAAATGCCTACAGCGACAATGAAAACCAG
CACGATATTAGTGAACCAATATATACACTACAAGCATCATCAACTCCGTACCAGTGCCGATATCCATGAACTCCAttgcttcaagcagctcataTGTCTT
CTCGGAAGAtaaatctgctgctgcacgcgTCGATGCAGGCACCGCTGCTCGTTCTTGGACAGCAGGTACAGTAGTAGAAGGCACAATCTTTGGCACTACC
GTCGCTgatgtcgttgctgtcactggagTTTTTTTATTTCCGGTTGCCGTAGTCGTAGCTGTTCGATTCGACGTCTTGAGGTGTCTCTGCATGAGTCCGA
CACACAGCAAACTCAGATTGAGTTTGTACAGCTGCTTCACGAGCTCCGGTTCGTCCATAAAGAGTATCTGCTGTCGTTCATTTACAGTGAGCTGCTCCCA
ATAGTGATGGATACTTttcagcacagcagcgccatcctcatcttcattgaCACTGCGTCGTGTCGCCAAGGGTGTGGCCAGCGCCATCCAGATGGTAGCA
CCTGGATTTCTGTTCGTCAACGACTTGGCTCTCTTCCAACCTCTTGTGACTGTATTAGAACTGCTTCTGCCAACTGAATCCAATGCATTACGGCCGTTGG
AGACGTCATTTGTGATTGGCGATCGGATGGACAAGTACGTTTTCCAGATTGGAGCTGCAACAGTAAAAAAAAGAGTATGAACAGATTAGATTTTTACAAT
AAACGATTGACCGACATGACGAATACTGTCATGCACCTTCCGCTGTCGACGAAGCTTTCTTAACGGAGGAGACGCTGCCTCGCGATAGTGATGTCATTCC
TTCTGTCAAATGCCAAGCAGAGCCAACGTTTTATTTGACTTCTGGGTAGTCAAATACATATACTTACTAGGAATTGTCCAGATAAATATGGCCGACATTC
AGCACCGTCGAGTGGCGCAGAAGCTCAAACAGGCCTGCGAGGAAACAGCAGCTCAGGCCATCGCGGCCACGACTGCGAGTGGACAGGCTAGTCATGTACA
CCACAAGAATCGCAAATTCAGCAGTCGCAAAGAAGCTATGGCAGCAAAAGTGCGTAAAAAACACTTTCGCTATTTAATTAATTGACTAATTTATTATTTA
ACACAGATTGCAGCTGCGAAGGCTAAGCGCGAGGCCAAGGAAGCTGAACAATGAGGACTTTCCGATGAGTGCAGACGATTAACTCTCCGTGGAGAGTCCG
TTTTCCAGTCGGTTTCTGCAGGAGCTATTAAGAGGTTAttctgaagaggaagtgTTTTACTATTTGTCATCATTGCAactttttattttgcttcaGGAGT
TAACTTCTGCTACAGACAGCAGTGACAGATGCAAGAGGTGGAGAAAAGGCAGTCATGGTCAGTGCTACGAGCTTTGGTGATCAAGAACTGGACGATCAAA
AGACGACGTCCGTTCTCGACTTGGAGTGAAATCCTCAACCCTTTGCTGTGCATTCTATTGTTTGTCGCACTGAAGAAGTTTGAACCAGACTTGGAAATTC
CAGCAGGATGGGCTACGAGCAATGAAAACAAGTCTGCACCTGGTTACGGAATCACTTGGAACCTCTACGAGACGACCGATTACGCTTCAGCTCTAGACGA
AGGGCTAAGTAGTGCTGGGATTGCTGTTCCTGAGGATTCACAAAGTGTGGTCAGTGACGCGTCCAATTCGACGTTATCAGCTAGCACGTTGCTGGGGGTG
TTAAGCAGCACCCTTCGAATTCCCAGGTTCTACTTCACAGAGGCAACTATACCAGGGTTGTTATTGAGTTTATCGCTTCAAGCCATGATGGAGGGTGACA
AGCTTGAGGAGCTAGGAGACGACCTAATGAGCTGTGCACTCaagtttttgctgtttggtTATACTGGAGCAGAGCGGACTACTTATCACGTGCCTAGCGT
CTGCCGGGGAAAAGTTGTACCATACAAGATTGCCATCACGCCGGACACTCCATATACACGCGAATATTTTGCCGCTGCACTGGAAACGTGGTACCCTCGT
ATTGATCTTACACCGTCCGTTCAGGGCATTTCATTATTAACAATCCCAAGCTTCACCGACTCGCACGTGTTTTTCGCCGATGAATCAGCCATGGAAGCGT
ACATATCCAGCAAAGAATACGGTACTGATGTTCAGCACCCGAAAATTTATGCGGCCATTGCTTTCCAAGAGTTTCCTCAAGACTCTTCGGCTTTTGGTGA
CGTGGAGGGCCATTCAATTGAATACTCTTTACGCTTCAACTCGACCGGAAGCCGCCCTGTTGTCCCGAAGACAAAGAAACCGAGACTCAATGCAATCTCC
AAATTTGTATCAGCGGACGACACCATGGCTTACGCAACACGAGGCTTTATGACTCTACAGACTCTCGTGGCACGCTTTCTAAACTGTATACCAGCATGGG
ATACGAAGTCGCAGACAACGGATGGGGCGTGCCAAATTCAAGAGGCGGTAATGGCTGCAGATAACGAAACTGATAGCAGGTTGCTCAGGCAGCTCGAAAA
CGACATGATCATCGACTTAGCATTTGCATTGATGAATTCCGTCAAAGATATTATTCCCGAGCTTGCCTCAGTAAGCTACTCGAACGTCTCCGTGGAAACC
ATCCCAGCACAAAGCCTGGAGACGTTACTAATCCCCTTGCGCATGGCACCTCAGCCATTCCATGGAGCAGGTGTGTACGGGAGTCCGACTCAGGCGTTCC
GCTATGCACCTTTCTTCGACAAGATTGCGCTCGTATTCCCCATCGGTTTTGTTCTGTCTTACCTGTACACAGTTTCGCGGATCATTGTGTCGTTTCTCAT
GGAGAAAGAAACAAGATCCAGAGAACTCATGCGTATCATCGGTGCACGGGATAGCGAACTATTTGGAGGCTGGGTGCTTGCGTATCTGCCGATCCTGTTA
CTGGGCACATTTCTGCAGACAATTGGGGCACACGCGATGCTGTTTCCGAATTCagatgccaagctgctgttcatattcttcttcactttcgcaacaagca
gcttcagttATGGCTACTTGATCAGCACTATGTTCTCGCGAGCGCGTGCCGGTTCCCTAGCTGGTATGGGAATATTCTTCATGATGTTCTTCGTATCATT
CAGTTTCAGCGACGAAACTATCGAGTCTAGGCGCACGGTGGCAGGACTCTTGCCACCGATTTCTTTATCCCAAGGCATCAGTGTGGTCGCGAAGCTCGAG
TCATTTGGCGTGGGGGTGAATCGTTATAATGCCCACGAATTAGTTGAGAACTTTCGTTTCGCGAACGCTATCGGGATGCAAATTCTGGACACAATTCTCT
ACGTTCTGCTGGGAAAGTACTGTGAAAAAGTGGTTCCGCAAGAATTTGGTGTTGCGGAGAAGTGGTATTTTTTTCTGACAAAAACGTACTGGTTTCCACA
AGCGTCCCAGCTAGTGTCAACGGAAACTCTAGTCAACGAGGAGGCTGGAAACATGGCATTGGACGCTGACACAGTGGAACCAGTCCGACATGAACTGaga
cagcaagagaagaATGGTCGCGCTGTGTTGATTGCAGGCTTACGGAAGGAGTTTGCAGTCCAGGGAGGAATGAAGATCGCGGTGCATGGCCTACACTTGA
AATTGTACGAAGGAGAAATCACCTGTCTTTTGGGTCATAATGGCGCGGGTAAAACAACAGTGATGTCTATGCTAACGGGGATGACTCCACCATCCAGTGG
TGACGCCTGGGTCCGAGGTCATTCCGTTGTTACAGGCATGCGTCTAATACGCCGCTCGCTTGGATATTGTCCTCAACACAGTGTCCTATACCCGACTTTG
ACTGTGGAAGAACATCTACTATTTTATGGGCGCATAAAGGGGTTTACTAATGGCAAGAACCTTGCCGACGAGGTGACCAAAAAGATAAACGAAGTCGGGT
TGGCAGATAAACGCGATGTGTGCGCGCATGCGCTCTCAGGTGGGATGCAACGAAAGCTGTCACTCGCCATTGCATTCCTTGGCGACAGCACGGTGGTGTT
TCTGGATGAACCGACTGCGGGAATGGATCCATACAGTCGACGCAGCACGTGGGAGCTAATTCAGCGGAATCGCGCAGGGCGTGTAGTGATCTTGACAACT
CACTTCATGGACGAAGCCGACATTTTGGGCGACAGGATCGCAATCATGGCGGAAGGAAAGCTTCAATGTGTGGGGTCGTCATTGTTTTTGAAAAAGCGAT
TTGGTGTGGGTTATCGTCTAAGCTTCGTGAGGCAGGGTGGCATATTATCCCAATCCATCACCTCATTAGTCCAGCAGTACGTCTCTCAGGCACTCGTTGC
ATCCGACATTGGAACTGAGCTCACCTTGCAGTTACCCTTCAAGGCATCTGCTGGTTTCTCGGCACTTTTTCGAGAACTTGAAATCAGACAGCACGAACTA
GGTGTTCTCTCTTTTGCCATATCCGTGACGACTCTCGAAGAGATTTTCCTTAAGGTAGCAGAGATCGGTAGTGGCCAATTACCATTCGACGAAGCCTGCG
CAGAAAATGTAAAACGTGGTGAATCGTCCAATGGGCAGCCTTGGGAGACAGTGATTGCAGTAAAACCACAGTCAAGAAGCGACGTAGAAGATACTTCTGG
GGTGGAGAGGTGGCGAGCAACAACATCGAGCGCGGTCAAAACATTTATGAACCAGATGAACGCCTTACTTCGGAAGAGAGCTCTATGTGGTAAACGCGAC
TTCAATATGGTGTTTTTCAGCACTGTCCTACCAGTTGCAGCCATCTTCATCGGTCTTTCAGCTTTAAAGCTGAGCACAATCCTAGTGGACGATCCGAAAC
TAGATCTTTCCCTCTCTACGCAATACACACTCGCAGAGCAAACTCCAGTCCCGTTTGGTTGTCCCACCAATTTTGATGTCaggggtggtggtggtggaaa
GACTGAGTGGTGCTCTGACTTGGTTCAGTCAGCTTTTTTCTTGGGTGGTATTGCATACCAACTTGATTTTGACACGGTTGTATACAATGGAtcaacaaca
ccaactgTCTTCGGAGTTGCGTATAATTCTCCGTCAATCGAACCAAATGACACTACGGGTTACAGCCTTCGCATGGGAGAGTTGGTGTTCGCGAAAGGAT
ACGGATATGCCGATGGCGCTGGGTTGAATGCACCGCCGCAGGTTCCCGTGGAAGGTCAATTTGGTGGATACCTTCTCTACGCGTCCGAAACTACAAATAC
TTTGAGCTACAATGTGCTGGCGAATGCTTCATCAACTCATGCTGCGCCCACGTACAAACACATGATCGATAGTGCTATTCACCGTTTTCTGCTGTCCAAG
GCATCAAGCTCGACCAAACCGAGTCGAAATGTTACGATTCGAGTGTCATCACATCCATTGCCGCTGTCCTACACGACCCGCTCTATCTTCAGCTCGTATC
TCAGCTTCCCCGCTGTGATATGCGTTGTAATAGCCTTCACATTTGTCCCCGCGTCGATGATGCCATTCCTTGTCAAGGAAAAGCAATTGGAACAGAACGC
TAAGTACCAGCAACTGCTTTCGGGAATGTCGTTCTTCGCGTATTGGCTGGCGAATTTTGTTTTCGATGTGGTGCTGTACCTCGTACCGATGATAGCAGCT
CTTTTACTTCTCCGTTGTTACGGCGTTACGTCATCGCTTAGTGGAGCCGACACGTGTGACTCGTGTACACAAGATGTACCGGCAGCTACGGTTACACTTT
TCGTGCTTTTTGGTACCTCGATTGCCCCGTGGACGTATCTGCTGTCTCATGTTATGAAACAACCCGGTGAGTGCCTGCTTTACACGGTCATGATCAACTT
CTTTGTGGGacttttgctgttgctgctaaGCTTTACAATGGACGCCTTGGACTCAACTCGAGAAGCAAATTCGGTACTGGTTTACATTTGGCGCATCTCA
CCACTGTTTGCCTTGGGTGATGGTCTCTTCAAAGTACTTATGGCTGATCTACTGGCACTGTTTGGTCTTACTACCAAAAGTCGAAGTGCGTTTGACGCTG
ACGTTGCCGGCACGGATATTTGGTATCTTCTGATCGAATGTCCTGTGTTTATACTGCTCACGGTTGGAATCGATGTATTTCAAGGGGGAACTGGGCACTG
GCGAATTGCACAAATCTGGGCAAAACTGAACATGACACAACGCGTTTACAAACATGTGCCGTGCAACAACGCCAAGCTTCACATTCAAAAGCCCCGTGGA
GGCAATGCCGTCGATGAGGAAATTGATGGAGATGTTGCTACGGAGGCCCAACGCGTGTGTGACAACTTCCAGTCTCTGAACACCACCTCTGAAGTTGTCC
AGATACTCAAACTCGAGAAAGTGTATGCGAACGGGAAACGAACCGTAAAGAATCTTTCGTTTGGCTTACAGCAAGGTGAGTGTTTTGGCTTCCTGGGTGT
GAACGGTGCTGgcaagacaacgacgatgaaagTCCTCACAGGCGATTTATTGCCGTCATCAGGCACTGCCATGATCACCGGTTTTGATATCTGCAAGGAT
CGAAGTAGTGCGCGGAAGTCGATCGGGTATTGCCCACAGTTTGATGCATTGATTGATTTGCTGACTGTTCGtgaacatcttgaactttACGGCCGATTTA
AAGGCTTTGAGTCCTCTGAGAGTCTCAAGAAGGAAGTGGATCGATTGTTGAACAAACTGCAAATCCAAAGCTTTGCTGGAAAGCTTGCCGGGAGTTTAAG
TGGTGGGAATAAGCGCAAATTGTCGCTAGCAATTGCAATGATAGGAGACCCCAGCGTGCTAGTGCTGGACGAACCATCTACTGGCGTTGATCCATTCTCA
CGCCGACTGCTATGGGATGTAATCCTGGAGGCATCGGTGCAGTCACGACGATCCACAATCATGCTAACTACGCATTCAATGGAGGAGTGCGAAGCTCTCT
GTAGTAAAGCCGGGATCATGGTAGATGGCGGCCTACGTTGTTTTGGCAGCATTCCGCACCTAAAAGCGCGCTTTGGTGACGGATTCATGTTGGAATGCAA
GCTGGAGACGCCAGATTCCGAAGAGATGGCGGATTTAATGCGCCAAGTTTGCGATCACCTGAAAGATTCGGAAGTTGTTCACTTCACTGCCTCCCGACTT
GAAAGTGTTTGTGCAGCTCTTGACAGCGCTGATCGCGCCTCTAAAGAGATAGTCGCGGGCGTACTGACTCAACAGGGtcgtgatgatgacactATCGACG
TCGTATCATTTTGCCATTGGTGGCTGTTAGAGGACCGCGCGCAGCGTCTGGACGAGTTCCTTCAAGCGCGATTCAGTGGTGTGACGCTCCTCGAACGACA
AACAGATTTCTGCCGCTACAAAGTATCTGGTATTCCCAGCACACAGACAGAAAGTGCTTTTACGCCGCGAGATGAAGTGGCTACTGCATTGTCTTGCATG
TTTGAGGTTGTAGAAGGCGCGAAGAGTGCATTGGGCATCAAGGAGTACAGCTTGTCACAGACAAGTTTAGAACAAATCTTCAACTCGTTTGCACACCGAC
GCGATGGAACGGGGCTGGGGCACTAGATTTCACACGGAAAATGGCACCATCGACGCTGATTCATCAGTGGATTGACTAATCAACGTACAAGTGTAGCCTG
AGATCAGCGTTGACATCGAGCATCGACTACAAAAAATATCGATTCCGATCGTGCTATCCATTATTGAACACACGTTCGACCAATGCAGACACACTGACAA
GAATTATCCGAAGCTATTTCGACATGACGATAGATCGACGATCACGGACGTCGAGTCGTACGTGCATCGGGGTCGAACAGTAAAAAGCCTTGTACGGTCC
CACTTGCATTACCACCACGGTTGCAATGCATCGAGTTCCCCCTGCGTGGTAAAATGACAACAAGGTTTGTTTACTTCCCCCATTGCGTGTTGATCGACAT
CGCAACGACCAGCATTAGTCAAGCACCGCCTGGTTTCGATAGCTGGTCCGCCTTGAAGCTGGTCCACAACCACACAACAGCCGTTtcaaacaacaaaaag
acACCGTCTTccattggctgaaaagctCCGCTCTGACTTCCCGCAAACCGCCTGCCCCTGATTTACTTTGTCCTCGCCTCTGCTCATTAACCAATTTATC
CTTAAAGTGTATAGAGGTATCCCAGCCAGCACCACTCAACATGGTCAAGTACGTTCTACCCGTTTCAGCCACCGCTGTGGCCATGCTAGCTGCATCCACG
TCGGCGCTTGACCAGAAGATCTACGGTCTCAACTATGACCTGCGCCAGGGACCCGACTGGGACCCGAGCAAGTGCAAGTCCTCGGACACCATCGCGTCCG
ACCTCAAGATCCTGGCCGACATCACGTCCAATGTGCGCACTTACAGTCTGTCGGACTGCGACGTGTCGGGCGTGCTGAAAGCTGCAAAGGAACTGTCGCT
CACTGTGTGGCTGGGCGTCTGGGTGTCGGAGGACTCGAAGGTGTATGACGCGGAGGTGGCGgccttcaagaagctcatctCTAGCAACCTCATTGACGAC
AACGTTGTCGGTATCAACGTCGGCAGCGAAGCGGTCTACCGTGAAGATATCACTGCTGAACAGGCGATCAAGTACGTGACGGACTTCAAGAAGGTCATGT
CGGAAAACGATATCAAAGTGCCCATCAGTATCACCGACATCATTGACACGTTCGTGCAGTACCCGGACATGCTCAAGGCTGGTGACATTGTCACGATCAA
CCAGTTCCCTTTCTGGGAGAAGATCGAAGCTGACAAGGCCGTTGCTCAGTTCAACAAGCGTATCCAACCGCTGCTCAAGCTTGCAGGTGACATGGAAGTC
ATCATCAGTGAGACTGGTTGGCCTACGGGTGGTTCCGCTACCAACGGGTCGGTTGCATCCGAGGAGAATGGAGCCATTTACTTGAACGACTTCTATGATT
TGGCCACTGAGAAAGGATGGAAGTACTACTACTTTGCCGGCTTTGACACGCCGTACAAGGAGAAGCAAGCGGATGACGCCACCACGGTCGAGTCGCACTT
TGGCATCTACGACGATAAGGGAATTATGAAGCCGGCATACGAGAGCCTCAAGTTcaccaagtcgtcgtcaACCTCTTCGACGTCGGGAAGCTCCACCACG
GCCTCGTCCGGCTCTGCATCCACATCGGTGGGTGCTGGCACGGTGTCCCCCGGCACGTCGAGCGGTACGTCCGCTGGAAAGTCCACTGGCACGTCGGATG
GTGACAGTGCAACGACGACATCGTCCTCAAGCATtgcgtcttcgtccagcatctCGAATGAAGATAGCGGTTCGTCGCAGTTGGTAGCGGCCGGCCTTGC
AGCTTGCATCGGTGTTGTGTCTACCATGTTGTGGAGCCTGTAAGCAGTAGTTTAGCAGCTCCATTCCATACACAGAACTCTGCATAGGAAGACAAGCGTA
ATTCATATGTTCCTGGTCAATGACAGATATGATATGACCAGTGGTCATATCATCTAACCTCTTAAAAATTATATTCTGCTGAAATAACCTGCACAAATCC
TTCATTACACGAAAATGgagagtgctgctgctcaagccaACGGGGCGGCCCATGCTGAGGCTTCGGAAGGGCTGCTCGTGCTTGTGATAGACACGAACCC
AGTGCACTGGTTCGCTGAAGGTGCAGGACCAGCCGACCGCGCTGGCCTACAGCAGCTCATCTCCAGCACCCTCGTGTTCGTGAACTCATACTTATTGCTA
CACCGCAGCAAtcgcatcgtcatcatcgctgcCCATGCAGGTAAAAGCGCCATGTTGTATCCAGACCCGAACCAAGAAGACACGAGTGGGAGTGCAGAAC
AGGCCGCCAAGGTGAACGCTGGAGTGatgcagcgtctgcaagaGCTGAGTGACGCTCCACTGGACCCTGCCAAGCCTAACCGAACGGCCATTGCGGCTGC
GCTCTCACGCTCCTTGTGCTGTACGTTTGTTGTATGGTGCTAAAGGTTTTAGTATATTGCAATGTACTGATGTGATGTTTATATTGCTATGCTTGCAGTC
ATTAACCGTGCTATCAATGAGGAGCCAGAGCTGAAACCGCGGATCTTGGTGATTCAGAAGTCGCCTGACATGTCGGAGCACTACATTGCCATCATGAATG
GCATCTTCTCGGCACAGAAGAGGAGCGTGGCAGTGGACGCCTGTATCCTCGCGTCGGAGCAGTCGTCGTTCATGCAGCAAGCCGCGTATCTTACGGGTGG
GATCTACTACAAGCCCAACGATCACAGCGGACTGCTGCAGTACCTCATCTCGATCTACCTGCCAGATCCATCCACGCGGAAACTATTGAAGTTGCCATCG
CAGGACTCGGTGGACTTTCGAGCCATGTGTTTTTGCCATCGGGAGGTGATCTCTACGGCTTATGTGTGTCCTGTGTGCCTTTCGCTCTTCTGCGAGTTCC
GACCCATTTGCTCTACTTGTGGTATTCGTAGCCACATCCAACCCAAGAAAAACGggttgatgaagaaacgTCCACGCGTGAATTAATAAAAATGCAACTG
CATCAAAAATGCATTCACTATTACTACATGTACCATCATGCACTGCAAGTCCCATGGTGCAATTTGCAAGGTGTAGTGCACCCGAAGTATCGCCCGCTTG
TTGCGTGCTTTGATTGGTCGAGAGGTTTTTTATGGCAAAATCTTGATTATGCGCACAAATGCATCTCCTGGTTGGTTAAAATGACTatattttagccaat
ccATTATCGTTTTGACTTCTTTTCGCCCAATCCAAGCGCCACCGGAGCAGCGGACGAACCTGACGTTGCTGCCATTCTCAGAATCGCCACGCAAGTAGCA
AAGCAACACATTACCACGTAGTACAATGAGCAGGTGCGAGCTGACACCAACAGACCTTCATGTGTTTTCAATGTCTAATATTTAATTAcaatgctgcaac
aacagacCAACAATCGCACAGGTGATCGCCGAgcagaaggccaagaacacGGCCGCCTTCATCACGTTTGTGCCCTGTGGATTCAAGACCAAGGTCGACA
CTGTGGAGATTCTGCTGGGCCTGCAGCGTGGTGGTGCCAATATCATTGAGGTAGGCATCCCGTACTCGGACCCGCAGGCCGATGGCCCCACGATCCAGCG
CGCACACCAAGTGGGAGTTGACCAGGGCATCACTTTGCACGATGTCTTGGCCACGGTGAGTGAGGCTCGCACAAAGGGTCTCACAACGCCCGTGGTGCTT
ATGGGATACTACAACAACATCCTGCAATATGGAGAGGACAAGATCTGCCCTGACGCCCAGAAAGGTTGGTGTCTGAGGTTTGCTGGGAAAGGATTAAACA
CGCTTCTGACTGTATTTTTGTGTCGCATATCGGTAGCTGGAGTTGACGGGTTTATCATTGTGGACTTGCCGCCtgaggaggccaagcagctTAGTGATGA
TGCTGCCAAGCACGGTCTCTCGTACATTCCTCTGGTCTCCCCCACGACGACCGAAGAGCGCATGAAGCTCATTGACTCGGTGGCGCACGGCTTCGTGTAC
TGTGTGAGTCTTACTGGCGTCACGGGCGCTCGCACCCAGTTGCCACCTAACCTTGACGCATTCATGGCCAAGAGTACGTTGCCCTTCCTCTGTTTTACTC
AGTGTATTAATTTCAAAGTTGCTAACTTGCGTCATTGTCATATTGCCGTGCAGTTCGCGCGAACGTGAAGCACCCGCTGGCGCTGGGCTTCGGACTATCA
ACGCGTGAGCACTTTGTGCAGGCGAGCGCTCTTGCGGACGGTGTCGTGATCGGCTCTAAGATTGTCAAGATCATTGAAGATGCATCTGACACGGCCAGCC
GCGCTGCCAATGTCGAGGCGTTTTGCAAGAGCATTGTGAACCCGTAGACTGTCCTGGACGTTAGAAGCAGTCTAGCGCGTTGTTCTCGCTTACTATCGCC
CTCAATATACTAAATAGTGCTTCAAAACATATACTGGGCTCGCTGTTGTCAGCAGCATGTGTTAGTATGCGTTGGTGCTAACTTTGGCCATTTTGCTCTT
AATGCAAGCATTTATATTAGTTTCGACTAATTCCGAGGTTGAGTGCTGTTGGTTCAGCTGGATAAGGCGCTTGGCTTTGCAGTCGACGGCGTGGGTTCAA
TTCCCGCTGTTGCCGAAAACGCGCAAGTAGTACCGTAAGTAAATTCATAAGTTCGCATACTTCGAAGCCCGGTGTGTCTGTACTATTAGACTAAGGATCG
GGTCAAAATGTATGCAATAATGATAAATTAGCATGTCAGGGTGTCAGTACTGGGTGATTGGTAAAATACACCAATTAGTCTCAGAATCTGCCAATCGATG
TGCAAACATATCTTTTATCACCAAGGGACGTTGACACGCTTCCTACTGAGCAAACGATGGACGCGTTGGAAGCGATGAAGAACAAGGGCAACGCGCTGTT
CCAGCAGAAGCTCTACGAAGAGGCAGTGCGAATGTATAGCTCCGTGCTGATTAAATTGCAAGAGTCGAGGATCAAtagcgaagcagcagtgcgaTTTGAT
ACAGCAGTGCGACTAAATCGAGCGTGGGCTTGGATCCAGATGCCCGGCAGGACGGATGAAAGGActctggctgctgctgaacaagaCTGCAGTGCTGTGA
TCGAGAGAGATCCAGTCTGTGTAAAGGCTTTCTACCGCCGAGCGTTGGCGCGAGAACGCAGAGGTCACTGGAGGGTCAGTCAGCACTGAAAAACGTTGCT
GTGAAAAATATTGATGTACTTGTCTGTCTTTGAACGCATGCAGTTGGCGATGGAGGATGCAGTTACTATGGAGCGACTGGAGTCGGCAAACCCGTCTGTG
GGCCCTTTGATAGAGAGACTTCAGCTGTTGattcaagatgaagaggaagaccTGGTGCCGAAAATGCGAGATTGCACGGTCAATGGCAATGCCACGTCAG
ATGGCGCCGCTGTTGCCAACAACGGTGGCATTCTGAATGAAAAGGCAGAGAAAGTGTGGCGCTTGTTGCAAGCAGATGAAATGGAGCTACAGGAAGTGCA
TCATTTGACTGCGAAGCGATCATCCATCACACAACGCAAACCCAGCGAAGCGCAGAAGGCAGCACTGCAACCTATGAAAGGTGAGATCTCTCAGAAAACT
GAGGATCTGTGGGCCTCACTGAGGCGAGAGGAGACCACGGCCATCGCGAAGGCATATCCTAGAGCAAGGAAGAGAAAAGAAGGGCAAGCCGTGTGAGTAT
AAAGAGGAATTGAATAAATTCATTGCATGTAGAACATTGGAATCAAACGAATAGTGGTGTAAGCGGGATTTTACAGTACAAGGGGCTCTACCAGTCGTCG
TCATTAtcattgccatcactttCCAGATCGATTGTCTGAGGGCGAGATCGCCGATAGCGAAGGCCACAGCCAACACAACTTTGGTTAGACGATGGGTTTA
TCAATGTACAGCGAGAACAACTCCATACCGGAGCCTCGTTACCTGTTTTTTtcgtttgctcttcttcaacatcgtGGATCGGCTCACGCTGGGTCGCTGG
AAACTCGTCCTCAAACTCATCCACGCGTTGTTTCTTAAGTGAATGTGACTCCAATTTATCAGTCGGTGCAAACGTCACCCTCTTCTTCGAAGGTGACACT
GCTGCCGGCCCAGAGTGAACTGGATGAGACGACTCCTCTAACGAATTTACTGTGGGCCGATGACGGAGAGGTGGCTGCGGAGCTGAAGGTGTGTTCGAAA
TCTGGTCTTCACACGTCGGAGAATTCTGTTTAGGAGCAGGTAGATGCTCAAATTCAGCCTCACCTTCGCTTTCTGATTCAGTCTCACCGGGATgtccttc
gtcttcttcatcactgctgctgctgctcaaaaATTCGCGCAAGTCGTCCGAGTCTACTGAGTCCTTGCGCTTTTTTGATTTGGATGTCGATTTCTTTGAT
TTTTTTTCCTCCTGGGCGCGTTTTTTGTTTGCAGCCTCAACTATTTCCATACGTTTGCGTTTGCGTTCTTCGTCACGCTGGTTCTCTTTCTCCTCGTTCT
CAGCTTGGTGCTCCTGCAGAAGTTCCCAGTCGATGCGGCAGCTGAACGCGAAACTCACGAGGTCACTCTGGACTTGCTGAAGCGCTGCTTGCATCACCTC
GTCATCGACAGAGGTATAGGAGCGGTGATGGCCCCAGCTGTTTAAATCTTCTTCCGGGGGCATTCCGATTTGCGGGTGATACCCCTTATCTGAGTCCCCA
TCACTAGAGACGTCATTTTTAGTTGTGTCTTCTCCACTGCCCTCACTGAGTCcggcatcatcgtcattATCATCAATCATGACCACAGTAGAAGCCTTAT
CAGGATCATCGGCATTCCTCCAATGACAACGATCACACTTTAGTTGATCGTGTGTATCGGACATGGTGTCCTTCTGAAACACGAATAGCCGCTTCAAGTC
TTTCGATGACAACGAATTCACCTCCTCCTTATCGTCAACGATATTTTGAAGGCCTTCCTTAGATAGCTGGCGCTGAAAGATTTTTTCTTCAAGCGTTCCT
GTAGCAAGGAAACGATAGACATAACACATTTTCTTTTGTCCTTCACGCCAtacacgagcagcagcttgcttATCTGTGGCAGGGTTCCAGTCAGGATCAA
AGAGTACCAATCGATTCGCGCCAATCAGGTTCAAACCACATCCACCAGCTTTGCTTGAAAGCAAGAATGCAAAGGAATTTGTCGTTGGGTCGTTGAAGAT
ATCGACAAGATTCTTTCGCTTTTTGGCAGAAGTTGTGCCGTCTAAGCGAACAAACGGCAAATGACGCTCTTGACACAAACTAGACACCACATCTAGAGTC
TGTGTGTAATTGGATACGATCACGATCCGGTCCGTCGTTGTTTTCCTCATCGAAAGCATGAGGCGGTCTAGTAAAAGCATTTTTCCCGACCAATCCGGGT
GGCACGTGCGTACCCCAAAGCCTCCTCGTCGAAGGCGACCACCATCACCTCCACCGTTGTTCTCTCCTCTAGCTGCCGCAAAATATTGTGCACAATTTCC
AAATCCAGGCAACTTGGTATTGGTTTTCCCATTTTCGTCGAATATTAGCAGTGGGTGATTgcacaacttcttcaaagCCGTAATAGATGCCAACACATTT
GCGTTTTGCTTTTTCATCAGGTCACGACAAGCACTTGATGAAAGGAAGTGCATGTAAAGTTGCTCCTGAAGTGGCGACAGCGGGCAACAAATCACCTGCA
TCAACTTTGGCGGTAAGTGCTTGGCATTCAAAATATTGCCTCGACGCAGGATAAACTGGTTCACGATCTCACAGAGCATCGCCGAGCACGATTGCGCCAC
GTTACGTTCGTGATCCGATGAGTCAGGTTCTCGTCCAATCAAGATTGGCCCCAAGTAATTCTTCCGAAACTCGCTTGGAGTGCCAAGGATGTTCGGGTTC
GTGAAGTCCACCATAGCGAAAAACTCCTCCAGATCATTTTGCATCGGTGTACCAGACAATAGCACACGTTTCCGGCATGCTAACGACGACAATGCACGGT
TAATCTGCGAGCTAGCGTTCTTAAGTCGGTGCGCTTCATCACAAACCAGCAAGTCACAGCAACAGGGTGTGTCTGCAAATTTTTGCGCATGCATACGGAA
TGTCTCGTACGAAATGATGAGCACCTGAGCCGAAAATCCTGGTCGTGGTCGCTTGCTTCCTTCAATGAACTGGTTAATCCCTTTGATCACAGTCTCCCGT
TTCGCCTCAAACAAGGCTATAGTCTTCACTCTGccatgcagccacttgatgATCTCATCATCCCAGTTCTTTACCAACGAAGTCGGACACACCACAATTG
CTCGCTTCACAGTAGGCTTCAAGTCCATCCCCGTTAACAGCAATGTATACATCAACGTGATACTCTGTAGCGTTTTCCCCAGCCCCATATCATCAGCTAA
GATGCATCCTTGGCCATCGAATCCTCGTATCTGAGACACACAGTCAAACATGAACTGCACTCCTTCCCGTTGATGAGGCCTGAGAAATTTACCGACGATC
TCCGGaaccaccaccttcatctcTGGGTCTGTCTCGCTCTGCCACAGCACTAAAGGCGGTGGAGCATCCACCACAGAAACTGGGTCAGCAGCAGGCTCCT
CCACAGCAATAGGCTCTGGTTCAATAGGCTgaatctcctccacttccacttcTAGAGGCGGCAGTTCGTGTCTAACCAGGGGCTTCATGACGGCAGAAGA
CCAGCGTCGTCTCATCCCCAGTGTCTTGACCTGCAATAGGCGGCTGCTCTCTTCGGAgcgtcctccttctccacatGGAGACTTGAACGGCCGTCGTAGA
TGCTGAGCACGACGCGCTGGTTCCATCACTAGGAAGGACAGGAACGGGAGCCGCTTGACGGACAGCGACGCACCACTACGCAGCGCCTCGCGGTtctgcg
cttcatcttcccagtcgtcctcgtcttcatagTCGGTTGTTGAAGCCTTGGAAGAGCCTTTCACAGGCAGCACAAATGGCTTGAACTGCCCGCTACCGCT
TGCACCTGGTCGACGTCGCAGTAGCGACATAATTTGACAATTgtgacttggtttcagtatggGCGGAAAGGTGAGACCAGCACTCATGGATGGAACCGTG
TTTGACAAAAGCTGATAAATTCAACCAACCTTTGTCAGTTAATATTTAATCGCTAGTATTTAACACCTCACCTTTTAGAAGTGATTAATGGCTGCCCGCT
cgcagatgaaggcgttgcgGTATACGCTTGTGCGTCGGCTACGAGGGCCCTATCCAGCTACCACTTCGTCTGTTTCTTTTAGAGACGTATATCTACCATT
TGCGCATCTCCAGAATCGCCAATTCGCCGTGACGGCCACACACGACCCTCGTGAATTTCGTCGACCTGCTCCAGAACCAGTTCATACGCCTCCACTGCCC
TGGAAACTTCGAGAATCAGTGAATCGAATGCAAAATGAACTGCCGACTGGTCGAAGCAACGGTTTTTACAGTCGGGAGGTGGTGAATGCTCTGAATGTGC
CCGACGTCCGACGCGCTTGGATCATAGCGGAGACTTTGCATCGAAGATCGCCGGGTCAAGCCATTCTGTCGCTGTATGCGTacaacctgctgcttcgacA
TCATTGCAAACAGCAATTTACAATTGCTAATGCTAATTTGGCTCGGATATTGGGCATTTTGGACGTCATGATCGACGTTGGGCGTGTGAATCAAGTGAGC
TTTCAAGTGGCCATGGCTGCCTGCAGTCGTGCAAGGCATTTAAAAAGTGCTAGACAAGTGATCGAGAAGATGCGAGAGAGTGGTTTTGAACCGGATGCAA
GGGTTTATGGATTCTTGATCAATTGTTGCGCTCGGAAGCAAGGCTTGGTGGATATTGCGGACCGGTACTTTGACGAGATGTTAAGCAATGGTATCGAACC
AACGGTATTGGTGACCAACGCTATGCTACGGGTATATTCGCGTGGCAGTGGAAGATCGAAGTTAGTGTTTGGACTTGTACAGCGAACGTCTCAAGAGTTT
GATGTGTATCCTGACATTGTCACGACTCGCATGATGATTTATTATCTTTTAGGTGAGGGGGACGTTAAGGGTGCTGTAGATTTCGTACGAAGTGTTGGAG
GAGCAGGTGTCTTGCATGTACAGCGTCGTGTGATGAATGCACTGATCGATGCTTGTCGTCAACGTGGTGAATGGGCCTTAGCTGAAGACTCCCTCGCTCT
TTTAATAAATAGCGACAAAAGGGCCACTGATACCAAGAAGGATATACTAGAAACAAGGAAATTGGAGGAGCTGATTGGAAGACAAGACACTGTGACTGCA
CCGGTAGCTTGGACGCTGAATGAGCAAGACACATCACAAATGACATTACCGCAGCAGAAAGCATTCCGGTTGGCGCGAAGTCAAAATGAGAGCGTTGATC
GCGcgttgaagcgcatgaaTTCGATTTCGGCTCCGACTGGGTTGAGTGCGGTTATTGTGAAATTGTCTTTGAGGGCCGACGGAAAACTTCGTGTTTTGGA
TGACATGATACACTCCGGGAGggcaagtgctgcagattTTAATGCCGCATTGAGCGCGTGTGGGCGTGAAGGACAGCTAGGTGAGGCGAAAACCGTGCTT
TCCCGGATGAAGCAATACGCGGAATTCTTACCTGAATGCTTGCCAACAGTATGGAGTTACAACGCTTTACTCAACGCCTGCGCGGTCAGTGGTGATATTC
ACCAAATAGAGCACATCGTGAAtgagatgatggagaacgaCTTGTTGCCCGATtcggtgacgatgaataCTGTACTCAAGGCGTACATCACAAATTTAAC
AaacggtgctggtggaaaCCTGCAGGATCGTCTGAACAATGTGTTGCAGGCACTGTCATTTTTTGAGTGGTGCTCCAAATCCCAGATGATCAACCCTGTT
GCAGCAACATACTATTCGCTGTTTCGATTGTTTAATGTGTACCACGAGGGCAGCAATGACATTATTAAGCCTACTGGTGATACTTtcgaagatgatgagg
aatTTGATGAAAAGCGAGAGGAGGAATTGAACGCATGGATGGTGGAGTTTATATCAACCACATGCTGTGATGCCCCTCTTACATCTCTGGATGTCGGTGT
GTTCAACGCTGCTTTTGACTATTTCTATCGGCAGGgcgatgctgatggagcaCTTGCACTGTTCAATCTAATGGACAAACGTGGCTTCGCGCCTGACGAT
ACTACGTTGGGGTTGATCTTTGCAACTTATGCGAATAGCGACCAGAACGAAGTTGGTTTGAAATTTCTGGAACATGTAATGGATCAACCGGACTATAAAC
CTAGTCTGAACGTGCTGAATGGAGCCATACAAATGTGCGCCAATTCCAACAACCCGGACGGGGCTTTGGAATTGTTTAGAGCAATCGAATCATCAGATGC
GTACGGTCCAACTGCAGATACCTACGAACAAGTTGTGCGTGCGTATGCGCGTGTCGGGGATATAGCTAATGCATGGGGTATTGCGAGCGAGATGGAAAGG
AGCCTTAACAAAGTATCCACAGGCGTCTATAACCGCGTTCTGCAGGCATGTGCCGTatctgcttctcctgaaCGTGCCTTGGAAATACTAGATAGGATGA
GGTATTCGAATGGCGTTGCTACTCCCGACGTGGTGTCATACAACATGGTTTTGAAGGCTCTcatggcagctgcagtacatgaagacgaagaagaagaaga
cgatggcGAAAAGGAAGATGGTGAATATTATAGAGATctcgaaggagaagaaaatggCTCTAGTGGTGAAGGTGTCGAATGGGGTGGAAGGCTTGGTAGC
GGTGTCTCTGAAGATCAAGGCACACTTAAGAATGATACCGACGACGATTACGAACTTGAGCGACGTGAAAGGGCTTTATGGGTACGCGGCATTGTCGTTG
ATCTCGTTGAGGCTATGCGCAGAAGCCGCAGAGCAAAGCCTGATGACGTTAGCTACGAACGCGCGATTGCTGCATGCAGCGTGTACGAGGATCCGGAGGG
TGTAGTTGTCATTTTTGATCAGCTCATTGTGCGCAAGAAGGGGGAGAAACTTTATACCTTGAAACATCACCTTGTGAGTGATGGCAGCATATCGAGCTAC
CTCGAGGCGTGCAAGAGTTTGCAGGATAAAGAGCGGATAGCCGAAGCCTCATCATTTCTACACCAGTGGCACACTGCAACGGGCCAACCTTTGTCATTAA
ATGTGGTGACACACCTCCTAGACGCCCTCGAGGGTGTTGGTGAATGGCGCCGCGCCGTGCGGATGCTCCCCGACATGCAAACGTTGTTTGGAGTTGTGCC
CAGCGTTATCTTGTTCAACCGAGCCATGCAGATGTGCAACAGCGCAGGTGAGCATCAACTTGTGGCTCCTATTTTCACTACGATGCAGGACGCTGCGGCC
TACCTCGTTTTTCCTGATGCAGAGAGCTATATCCAACGGATTTACGCAGAGGAACAGCGTGAAGACTGGGTAACAGCCACAGATCTGTTcgtggagatgc
agaagaagtgcCAAAGCGAGGATATTTCCCACAAGCAACTCCAAAAAATTGCTTTGGGTCGGTATAGTTTACGTCAAAAAGAATGTTAAAATGTTAACAG
AGTTCTGATGTTCCTGTCTTGGCAACTCATATATGAACATTTTGCTGGTGCCCATAATTCACATTTGGTTCTCAAGTAgactctcttcttcgtcatgaaG
CTCCGAATTTGAGGTTGACGATACATTCAGGCCGAAGTTAGGGGTTCCAGGGAAACTGCTTaacgtggtgctggtactGCTGTATCCTTCTGAGCTGTCG
GCGTCAGCAGCGTAGATGGACTTGTCCGAGGCGAAGCAGTGGAAGACAACTGCGCCGAATACAAGGACTAGTGCAGCGATACCAAACACAAGGTCCCACG
ACCCGGTGACTTCGAGAATTGTGCCAGTGACGATGTTACCAACGATGCCCGGGATGGTTCCAAATGTATTGGAGACTCCCATCACGTGCGCGGCGTGGTT
GGGTGCCACGTCGATCATATTGACCCAATACCCTGCCATGGCTGCACGGCTAGTGAACAGTGTCAGAGACAGCAAGCCCACCGCCACGGGAGCGGTCTTC
GCCAAGCGCAgcgagaagaggaagaaagcgcACCCTAAGAAAGAAAACGCATTCATGCCCTGACGCACATGCAGCTCACGATATCCACGCGTGACAAGGA
GGTCTCCGATCCGTCCAAACAGCAGCGTGCCAGTGTACCCGCACATGTAAGgtaacgcagcagcaaacccACCCTTCTTGCCTAAGTTGATATCCAACAC
TTGCTCAAAATACTGCGGGATCCATCCCAACAGGATGTACCAGCTGTAGTTGTAACACATATGCGCTACGTAGATGGCCCATGCCGGTCGAGAAGTCAGC
AGCACGCGCCAGTTCATGGCATGCGTGTCCAACTCAGCGCGAGAGCTCTGGCGGCGATGGGTGTCTGGGTCAATGGTGCGGTTACGCACGATGAAACTGC
GTTCCTCCACTGAGATGTGGGGATCCTCTTCCGGTCGACTCACCCCCATGAAAAAATACACCACGACCCAAATGAAGCTGAGCACACCAAACACAACGAA
AATACGCTGCCATCCACTCGTCTCCATGATAACAGGCGAAACCAGCAACGCCGTGATTGTGCCCAGATCCGACCCGCTTGCCACGAGCGACACAAGGCGA
CTGCGCTCTTGCAACGGGTACCAAGCCCCAGCAATTTGATGCATGCACGGGAACAAAATCCCCTCCCCAAGGCCCATACCGGCACGAGCGAAGAACAAAC
AGGTGAGGCATTTTGCCACAATAACCGTCGACAAGTCCTGACAAAATAGAGAATCACAGTCAGCAAAGAACCTCCAACTAGTCTTCATAACATCACGTAC
GAACAGTGTCCAGACAACAACTCCAGTCAACAACACAATCTTGGCTCCAAATCTGGCAGCAAAATAGGCTCCCAGAATCTATAGCAATGTTCACAAACAG
GCAAGAGTTGTAAGGAAGCTGAGATCCTGGGAGGGGAAGGAGATTGACTCATACTTGAGTGCACATGTAGCCATAGAAGAAAGCGGAAAGAATTTCTCCC
TGCTGTGTCTTGTTGGTCACGAACGCTGGCAATGCGATGCCCATATTGGTCCCTAAAGTATCCAAACAGACGCCACGAGATTTCATTAAGAACAAATCTG
ATCAAAGAGATTAAGGGGATCAATGTCACTTACGGTCGGCGTAGCAGATGGTGGAGACCCAGAGACACAGGAGCGCAGTCACATAACGGCGTTTGCCTGT
CGGCAACGTTCTAGAGATGTCGCCTCCAGCGATAGGAGCTTTCCTCCACGCTGTCTTGTCCGACATGGCGGTCAAAATGTCAAATGAGATCGTGTGCACA
GCTCTACCGTTGCACT