Description :
From Genome Similarity Track
Location :
Scaffold_2078:442- 1652
Sequence
1210 bases(100 bases per row)
ATAGTGGTGTAGGACATCTTGTTGTAAGGTTTCTGGCATCACCAATCTCATCAATCCATCCCGATCCTCGTGGACTCTCTTCGTAGGGGGGCAATAGAAG
AGCAAGTCATTCAGATCCCCTGCGTAATCCGTAGCGATAATGCTGTAGGATTTGGCATCCTCCCGACTTAAGTCTCGTACATCCCCCATCAGATACTTCT
TTAGTCCCAGGATCCACGCTTCCTCGTTCTGTGCTTTGAGGATCCGCTCAATGCGGACTCTCTTCACGAATGTTTCCTCGAGGATCGGGGGGGGGGGGGG
GGGGGGGGGGCTGGATCCAATCCTTCCTCTGGACCTAGTGACAGCCATCACCTGGACTATCCTTTTCCCGGATCCAACTACCACCACTTCGTCTAGTCGA
TTCAACGTAACGAGATCCTGATGCTCGACCTCTCTCTCCACTTCAACACCACATTGATTCCGTAAATGCGACACTGGCCAAACTATCTGCACTGGCATTC
CAATCTCGCTTGACATGCACCAACTCGTGATTCATCCAACCACGCAGGTGGATCATCATTTTCTGCCGTAACAGTGTTAGGGCCGGGGCCTTGCAGTCAA
TCTCACCTCGCACCTGTCTGACCACCAAGTTTGAATCCCCACAAATCACCAGCCTTTTTGGATCCTGTCCCTTTAGTAGATCCAAACCCAGCAGGAGTCC
TTTATACTCCGCTTCATTGACGGTGAGGCCTTCCGCGTAAGTGGATCTGGCCCGTACAACTTCCCATCCGGGCAGTCGCCACAGTATTGCGCTGTATGCT
CCTCCTCCGCGTCGTACGCGAGCGGATCCATCGAAACTCAGGACGTACAGATCCTGATCCACTTGTACCGTCGGGATCGGGATCTGGATCCGGCGTTTGG
GCTCTTTCTTAGGAGCGATCCTAGTCAGCGCTGATCCATCTTAGCTCGAGGTGTGATGCTCGCGGCCAAGACTCCCAGGATCTCGTCTTCCCCTTTCGAA
CATTTCACAATCTCCAGTGTCCAAGGCGAGAGTAAAGCTGCCCACTGTCCCAAACGTCCTTGTAACCCGGCCGACTCGAACAGCCAAGCTAGCGTAGAGT
GTCGAGTCCGGATCCGGATGGATCTTCCCACCAGCAGGTTGTAATTGAGATCCAACACGAGCAGGAGCGCGAGTATCGCTTTCTCCACCGCTCCGTAGTT
CAGTTCATTC