Description :
From Genome Similarity Track
Location :
scaffold_38:441950- 470237
Transcript NameFunction/comments
g12780.t1 hypothetical protein PHYSODRAFT_321823
g12781.t1 hypothetical protein PHYSODRAFT_343735
g12782.t1 U4/U6 small nuclear ribonucleoprotein Prp31
g12783.t1 hypothetical protein PHYSODRAFT_293746
g12784.t1hypothetical protein
g12785.t1 60S ribosomal protein L6, putative
g12786.t1hypothetical protein

Sequence
28287 bases(100 bases per row)
TGAGCAGGTTCTGTAGCATGGCGGACTCCATCACGTCATTCATCATGCGCATCACCTGCGCGCTCTGCGATAAGCTCTGCCCCACGCGCTCGAAGACCGA
CTCAAACGACTGCTGCAGTCCTCCGGTGTAGCTTTCCAGCATCTTGGCCATGTCGTCCATCGCTTCAGTTTCAAAAATGGCGCGGAAAGTTTCGTGTTTT
ACAGTCGGTAGTAGACTTGGCTACATTTGACTGCGGCAACTTGCAAACCTTACTCAATGGAGTTCTCGATATTTTTCTAGTCAACCGACTCATCCTTCGT
TGCAATAAATTACGATTGGGTTCTAATGATGAGGAAGTCACCTGGCGTTCTACTACGAAATCCAGTCGTCGAGGCGCAGCTTGGTCCTGGCAGACTTGGG
CGCAGCGACCTTGATGACTTATCTGCGGCCGTAGCCACCACGGTTACCACCGCCGCGGCCACCTCCACGGCCACCACCACGACCGCCAGTCATGTTACCG
CTATTGTCGCGCGTGTACGGCGAAGGCTCGATGCCAGGTACTCCCAGGAGGTTCATCTTTTTGAGTGTCCTCTTCTCGAGCTTGGGCACCTCGTCCAGAC
CGATCATGTCGCTGTATTCGGCCGCAAGTTGCACGAGCTCCACCGACTTCAGCTTGAGACGCTTCGCGTTCGAGTTGTAGAAACCGAGCCACGCCTGGTA
CGACTGCTGCGCCGACTTCTCCAAGTCACCGTGGTTCTTCAAGTTCTTCATGACGTTCAACGTGCGCGACTGGGACGGCACTAGCTTAGCCGGCGAGTAG
TTCTTGCTTGGCTCAAGAGGTAGGTCAGTCAGCTGGTTCAATAGGGTCGTTTCAAACTCGGACAGGATAAGCACACCCTTGCCCTTCATACCAGCACGCG
CCGTACGTCCAAGGCGGTGAATGTACTGGTCACGGTCAGTGAGACCCACCTGGAGCACTAGCGACACATCCGGGTAATCTACGCCACGCGCCGACACGTC
CGACGAGAACATCATGACCTTGTGGCCCTTACGGAAGGCCTCAGCCGTCTTCGTGCGCACCGCTTGACTCTTGCGTGAGTGAATCTCAAGCACACCCGGG
AAGCCCGCGGCTTGGAAAAGCTGGGCCATGAACTGCGCCGAGCGAGCGGTAGGGAAGAACAACATCACCTTGTACGCCGGCAACTTCATGTGCGCAGCCA
GCACGTGCTCCATCATGGGGACCAATTCCTTCATCGAGCACACAATGTACTCCTGCTCCGTCTGCGCGTTCGTGTCAGCCTCGTTCTCGTCGATCGTGTC
TACGAACGCGTAGTCCGAGCGCAGAGCCACACGCTTGAGCTCCTCTGTCGAAGCAGGCAGTGTGGCGCTGAACAGCAGCGTCTGACGCTGCTTCGGCAGG
TAGCCAATGATGCGCATGACATCCGGGCGGAAACCCATGTCCAGCAGTCGGTCAGCTTCGTCCAGGATCAGCACACTGGCCTTGCCTAGTCGGTCAGCGA
TCCTGCCAGTGTTCTGCTTCAAGTGGTCAACAAGACGTCCAGGAGTAGCGACAAGGATGTCAATAGGCGCGCTGCTCGTGAGCGTGCGTTCGTCCTTCTT
GATGTTGGCACCACCCACGAAGCAGGCCACGTTCAGCTCGTGGAACTTGGTGAGGCGCTTAGCCTCGGTCGCGATCTGCTGCGCCAGCTCGCGCGTGGGC
GAGATGGCAAGCGTTGGGATCGTGCCCTGGCGACGTCCCTCCTGCACCATGTTCTCGATCACCGGCAGCAAGAAGGCCATGGTCTTGCCGTTGCCTGTCT
TGGCCTTGGCCAACACGTCCTTGCCCTCGATGATGAGCGGGAACGTCTCGTTCTGCACGTTCGTGAGGCGCTCGTACTTGAGGTCTTCGACGATGGCGCG
CTTGGTCTGGGCCGAGATGTCCAGCGACGCGAACAGGACGTCCGACAGGTAGTCCAAGTTCGTGGGCTTAGAGGCCTCCACCGGCGCAGCATCAATGGGA
GCAGGAGCCTCCTGCGCCACCGGGGCAGCGGTCTCTTGGGTCTGCTCGGAGTTCTTACTGCCGTTGTTGCGTCGGCCGCCGCGACGCGGGCGCTTCTTCT
TGTGCTCGGCGTCGCTGTCCTTGCGGTCGCCGGCGGGCGCCTTGCGGCGCCAGTTGCCGTTGTTGCTGTCGTTGTGGTCTTGGCCCGGCATCTTGAGTTG
ACTTGGGTGCGTGCGTGGCCGCGGGAGAAAACTGAAGAGTGAGTTAAACGGCCACAAACCAACCGAAACGTGTCCTTTCGCGGGCAAGACAAGCCACTTG
GCGTTTGTATGCTTCATTGAAAACTACGATATGGCATACTGCGACAGTTTCTTTCCATTGATCTCCCGATCTTCCACTTCACAATATGCCACAACACAGT
TACCTACTCATGAAAATCCAAACACAATTAATTTTAAATACTTGCAGACATGTCGACGCTGGCCGACTCGTTCCTGGAGGACCTAGACGAGCTCAGTGGG
GGCAGCAGCGACGAGGGGGAGACGCCCACGCCTGTAAACGCAGACGAAAAGGCCGAAGACGGAAATGACGCCGACGAGCTGATGCCCGATGCGTCTCAAT
CGGCCAAGAGGAAGCGCCAAACGACCGAGGAAGAGCTGCCAGACGAGAAGACCCAGGACTTCGCTCAGGCGCTGCGCTCAAGCGTGAAGCAGCGCGGCGT
GGCGGCCGTCGCGACACTCAAGCGCTCACCCAAGTACCTGGCTCACGTGCAGGAGATTCAGCAGTTCGTGGACGTGGACGACGCAACAGCAGCCAAGCCC
CAGCAGCTCGAGGAAGGCAGCGCCGAGTACGACCTGGTGGTGACGTCCAACGACTTGATGGTGCAGATCGACGACGAGATCGAGGCCGTGCACCGCTTCA
TTGCGGAGACGTACGCCGCCAAGTTCCCGGAGCTGGACTCGCTCGTACCGAACGCTCTGGACTACGCTCGCGTGGTCAAAGCTATTGGCAACGCGATGGA
CCTGACGCTCGTAGAGGAGCTGCCTAAACTGCTGCCCAGCTCCGCAGTCATTGGCATTTCCGTCACTGGGTCGGGGACCAGTGGCAAACCGTTGGCCCCT
GAGGACCTCAAGACGTGCATGGAGGCGTGTGATGAGCTGCTGTCGCTGGAGAAGGACAAGAACATGATCCTGCGCTTCGTCGAGAGCCGCATGAAGTACT
TGGCGCCGAATGTGTCGCAGCTTGTGGGCACTCGCATTGCAGCGCAGCTCATTGGACTTGCTGGTGGTGTCGCGCAGCTTGCGAGGATCCCGTCGTGCAA
CTTGCAGGTGTTGGGGCAAGAGAAGAAGGTGTTGAGTGGGTTTTCTTCCGCTGCTGCATTGAAACATACGGGCGTCCTGTTCTTCAGTGACCTGGTGCAG
AGTATGCCCCCCTACTTGCGCATGAAGGCGTGTCGAGCTGTCGCTGGAAAGCTAGCGTTGATGGCGCGCGTGGACAGCCAGCCGCACCAAAATGACACGG
AAGGTCTCGTGGGTGCACGCTTTCGGACTGAGCTAGTTGGTAAAATGGAGAAATGGCAGGAACCTCAGAAAGCCAAGACGAAGAAGGCACTGCCGATCCC
AGACGAAAAACCGCGACGTAAGCGCGGTGGCAAGCGCTACCGCAAGATCAAGGAGCGGCTGCAGATGACGGATGTACGCCGTGAAATGAATCGGCAGTCT
TTCGCGACAGCTGACGAAGAGTATGGTGACAACGCCATGGGAATCACATCCGGCCGCCTTGGCCAGGAAGGATCGGGCAATTTGCGAATTATGCGCAAGG
AACAGAAGCAGTCGAGCAAAAAGCTGCGTGCCGCGAACTTTGCTGCGTCGTCCGCTAGCAAGCCACCGCTTTCTGGATTGGCATCGAGTCTTGCCTTCAC
ACCCGTGCAGGGTATTGAGCTGATGAATCCTGAAGCTGCAAAGGCTCGTGTTGCGGAAGCCAACAAAAAATACTTTTCAGCTGCTAGTGGGTTTGTGAGC
GTCGTCAAGAAGCCGTAGACTGCCGAGAACACTGTGATCAGCCTGAAAAGATGTTGTTGTCTTGCTCAAGTCAAGAAGATAATGATGCTCAAGGCACGAA
CAAGGGGAAACGAGCGGCTGAGCAATAAGAAGTTTTGGGTTTGACACGTTCGTGGTCGGTGCTTTTAGTGTCTGTCTTGCCCTGACATGGTACTCTACGA
CGCTGGTTGATATCTCTCAGGTCTATCTACACTGGCCTGTCGGTCAGCTCAGTGCCCTAAGATCTCGAACGTCGTGATCGATTGAGCTGGGAGACCCGCA
CTGAGTCTGGCACTCTGGCCAAATACGATGTCGGTGCTGGAGGTTTTGTATACGGCTCCCGATGTTGTGTTCAGCTCCGTTGTCCAGATATTAATGGGGC
CCTCCACGTACGATAGAGCCGACAGATCAAACGTAATGGTCTCTACGTCACCCAAGTTCGTAGCCACGATGACCATCACTTGGGTAGCTTTGCCGTAAGC
AACGACGAAGTTCGGGTATTTATCCAGGGCGTACGACGAGGATCCAGGAATGAGCGTATTGAGGTCGTCAAACTTGAGGATGGTCATGCCAGCACGGATA
TGACGCGAGTAGGGAACCATCACGTAGTGCTTCGGATTGGCCGTGCTGATTCACTGGTCACCTGGGTTCGACTGAATAAGCGCCACTACTCCGCTGCCAA
GAGCTTGCCTGTAGACGAAGGCCGATGCACCCATCTCATAAATGTCTCGAGCGATGGTCTCCGCTATGGTGAGACCAGAGGTCGAATACGTCGGCTCCGC
GCTTCGATGCCAAGCCAAGCATTGCTCGCTGCTTTGCATCCGCGTCCCAGTTCCAACTCTTTGGGTCAGCACGGACCCGACATCAGTCTAACCAGAACGT
CTCGATTGCATTGAACGCCGGCATGTTCTCTGACGTCTTTATGGCGATCTCCGTTCCACTATCATCGATGACGTTATTACCGGAGCCGCCGATGTTGTAG
CGTGCGATGTTGAAATCGAGTGCTGGAATGTCCTCTGCGGCGCCATTAATGGACACCGACGACACGTTGGTGAAAAACACGTCGGCGATGTCTTCGCGGT
CTCCGAAGACGTTGGCCCACCAGGAGAGCGAGGTTCCCCATCCTTCCCAGGACTCGAGCATTGTCGTCGTCGTTACTGAAATCGTGTGACTTGAGAAGGT
TGGGCGGTTAAGAGTGCCCAGGCCAACGTGGAGCTTGCAATCGATGCAGTCGTGAACATGTTTCTTGGATGCAGTACCAGTATGCTCTCGCACGAAGCAA
AATGGTGAATGAAGAGCGAGTTCGGTACATACCTGTATAAGCAGAGAATGAACCTGTTCAATCCGTGTACAGTTCGGTCGCTACCGCAATCTGCGCACAC
AGGAAGGGATAACGTGGGTTGCAGCGTGTAAGATGCGTGGATTACACGTTATCGAGTATAATAACGCTGCCTCGTTTTCTCGTCCAGACAGTAAAAGTCG
GCTGCAGTCTTGCCACGCGATCAGCTGGGGATCTGTGGATGCTGGGCAGGATCTGCTTCGGGAACTTTCAACTACGGCGAAACTTGTATTAAATACATGT
TGTTCATGAGCCCACGACATCGGCATTCACGTGTGTCGATGCAAACTCGCTTGGTTTCCACATGTATCAAGTCGCAGACTCTGAGATTAAGACAGCATAC
GTTGGAACAATCCCTTAGCATTTCATTTTTACGTTCATTTGGTTCCATCAGGTGCCTCCATGTTGCTCAAAGGAAGTACTCCTCGTACTTCTGCTCGTAA
ATGATGCAAAATCGTCGGTCGGGGGTGCGCCTAACGCGATGCAACGTGCCTGGGATGCGGCCTTCCGTGGCTCGATGCAGAGCATGACCACAGAAAAGCA
CAATCTCCTTACCCGGAACGCACACCTTCTCGGCCTTAAGCCACTGTTTGGAGTGAGGATCGTACACATCCAGTCCCTCCACGCTCGGTACAGGCTCCAC
AACATACAGACTCGGATCGATATGCTCGAACACATTTTCCGTCTCGGACTGGCCGCTTCCTTCAATGTTCGGGTAGTGCAATCCGTAGCAAACCGAAAAG
TCTTTGTCCGATCGCGCACCACTCGGCTCAATATCATAGCCGACAGTCAAGCTCAATGCACGGTCGCAGATGCGCTGCATGCGGCGCTGCAGACCCAGCC
AGTGGTCCTTAAACTCTGGTGACGGCCACACCAGCCTCGACATGTCCCCGCAAGCCACTCGGAAGCAGTCACGCACACTCGTGTGCTCATATCCGCAGTA
CCAAAACGGTTTGCCATGCTCGTTGCGGTACACGTGTTTGCTTGTGCATCCGTTCTTCCACTCGTCATCGTCGCTCGTGAAGAAGGTCTCAAAGTCCTGA
AGCACTCGGTCGTGGATACGCTCCAGCGTCTCACCGAGCTCCGTGAGCACCACGAACGAGTGGCGCTCCATCATCTCCAGAAAACGAGCGCGGTTCTTCC
AGTTGAGGTCACTCAGCCGCAGACGCGGCACTTGCACCGCATCGCCGGGAGTTTGTTCAACTCGTTTTTCGACGGTCTCACATGGCCTCTGGACGTCGAC
GACGACGTCGGTAATTTCGCCGCTTGCATTGAGGCAGTAGTAACTGGCTGCCAGACTGTAACCAGTCGGCATGGAGAAGCCTGCAGCGGTCATGTCGGTG
TTGGCGCGGCGCGAGGATTAATGCACACGAATGGCTACGACTCCTTGGCCGTGTCTTTGCGTCAGAGAACCGGGGCCCCACGTTTAGTGTCCAATCAACA
AAAGTTCAAGTAGATGACCATCACTCTGGTTGTGCTGCTGACAGCACGCTACGGGCCCGGTTGCCTAGCACCGTGGAAGTCGTTGGAGTGTACAAATCTA
CTGATTGGTTTATGGTATAAATTAGCGCGGTGCTCGACACGAAGATATGCATGTCGACATGGCGAAGGGGGTACGCAGTGGAGGGACGAGCACCAGCAAA
AGGTTTACCGGTACACGCTAGGCACGGCGCCTAGACGTCAAGTATCTTCGAGACGTGGTTGCCTTTGTATTGGCCCCGTGCAACTGGTTGTCCTCCTTGT
AGTCGAACAGACGCGAGCGCACCTGATCCAGACGACCCTGCCACTCAGGCGTGCGCGGTCTCCGCGTCATGTTGCCAACGTGCTTGGTCTTGTCAGCGGC
CAGGTTGCGGTTGCGCTCCTCAAGCTGACGACGGCGTTCGAGGTTCCTGGCTTTTGTGGCCGCAAAGCGCGGCGAGCTGTCGTAGTCCATGTACCGAGGA
ACAGACGTCGAGATCGAGCGGCTTTTCGGAGACGTAACCACGGGTGGCGCACCCCGCGCCGATTCCGAGAAATGGCGCGTCGACTTGACGGGCGGCGCAA
TGGTTGCTGAGAGCGAGGAGCGACGAGACCTCGCGGGCGTTGGTGCTACTGGAGGCGGGTTCTTAGCGGCATAGAGGGAAGAGCGGCGCGACTTTGGGGC
CGAAGAGACTTTGTCCTTGGTAGTGGTGGACGGCGATTTGCCCGTGAGCGAAGCACGTCGATATGAGTTAGGCGGGACAAGCTTCGAGGTCTTTGTCGAT
TGCAGGTTCTCAGGGAGCGACGAGCCTCTCGAGCGGTAGACGGTGGGCTTGACATTCTTGGAGGCTTCAGCACTGGTCTCGCCTGACGCCTGCAGTAGAT
CAGGCAGGAAGATGTCGAGCGAGCTAAGAAGCGAGTCCAGGGAGCCCGTGGATGCAGTGGAGTAGGACGACGGGCTGGGAGGGACAGCCGAGTAGCAAGT
GGATTTGATCGTAGTCGTTGAGTCGGCATCGCTTTCGTCTTCGTAAGAGTTAAAAGTCATGGGGTCATACTCATTGTCGGACTCCAGCGTGTTGACTGTG
AGGCTCCTGTAGACCGCAGGCTTTGTCGGGGTCTCTGGCACAGCAACTGGGGTCTCCCCCTCAGCAGGTTCCGTGACGTCCTCTGTCTTCTGCAATTGTG
CAGGCTCCGACTGAGTGCGGGTGCGTTGTGTGTTCATGCGCACGATGATTTCCTTCACCGGCGAATTTGGCTGCAACGGCAGATCCATGCGTTTAGATCC
GCCAACGGACCAGGAGCGCGGAGCTGCAGCATTGGCCTGCGCCATGAGCTCGAACCGGGCGATGAGAGTCTGCACACTCGAGGTGCTGTCCATTTTAATT
GCCTTTGTCTCGGTGGACGACTAAGATAGCGGCGAGAAGCGTTTCCGCGATGGGAATCTCGTTCGTGTGAGCTCTGCGGGTCCGAAGCGGAACTGGCAGC
GGTCGACACTAGCTGGCAGCGTTTTCGTGCTCGGCTTTCGGGGCGGGGCTGGCTCTTCCAGTCCTCTTTCTGGCGCTCGCTGAGCTCGTAACTCGTCGCA
CCCCAGTTGCCCGGCCAGTTCCGAACTGACCTGGCACAAAACGCTTGGTGCGGATGGCTTCAACCACGGGGCCCGCGCCGTTTCGACTTTCCGCCAATCG
TGGAGCTTATAGCGCATTAATGGCCAGTAGTGAGCCGCGATATTTAGGCGGGATAAAGATCGCAGGTGATGTGTCCAGCGACATATGCTGCGACAAAAAT
TCGATTTCCGGCCCATGCCGCTGCTAGCAACTCTGACATTTGATACTGTCGTATTTAGCAAACCATATAGACAAGCTATACAACAACGATTCCAAACATG
ATAACCTACTCTTCTGACATACTATGCTTTCCCGGAGGCCTAGTTTAAAACGGCCAATCAAATGAGGCGCGTCACATGCTCGCCTGGATCTGCTTCAACT
TGAGACCAAGTGTCAATTCACTGTCAATGAGGCCATGTATCACAGTTACCTGAGGCGAAACGCTAGAGCCGCTGGCGTCGATGGCCATGGGCGCAGCTGC
ATTGGCGCTCGAGGACTCGTGCGGGTCGATTGCTCCGGTGCCGCCGCGCCTCTTTGCCGGCAAACAGGCTAGGCGTCGGACCTCAGCGCGTCGGAAGACC
GTTTCTTGCGGCGTTCTCGCTCCTTTGCGATTTGCTCCTGCACGAAACGGCCAAAGGATTCGGCCAGGTCGTCGATGCGCTTCTCGTGCTCGTGGTTCTG
CGCCGACAGCTCGCGCTCCAGCCGCAGCACGTGGCCTTCGAGCACCGCGATCGCCCCCGCCTTCTCCTTCAAGATGGTGGCGCTCTCCACCGCCGCGATC
TTTGCGCTGGCATTCAGAGCCTGCAAAAAAACACAGCAACGCATCAGTATGCTGGGCAGGAGGCTCTGACAGACAGCTAGCGAACGTACATGGATCCGTT
CGTCGAAGGTTGCGTGCATCTGCACGAGTCTGGCGTCCTGCTCTTCTAGCCTCCGGACCTGCTGCTGCAACTTCTCCTCGCACCGAGCTCTCTCGCTCGT
CACTGCGGCTAGCTGCGCCTGCTTCTCCTGCAACGCCCTGGATTGCGTCTCCGTCGCGGCCTCGAACTCGCTCTGCTTTTCATCTCGGGCTTGCTGCAGC
GAGACGTTGTCTTGTCGGAGCTGGATGATGGTCTCAAGGTGTTTTTCCACTTCTCGCTCGAGGTGCTGCCGCGCCTTCTTCACCTCGGCGACTTGGGCCT
CCACCGATCCAACAGAGCGTTGGATGCGCTCCTGCAGCTCCGCCTCCCATTGCTGCTTCAGCTCTCCGACTGTCTTTTCGTGGCCAATTTGCGACTGCAA
AAGCTTGGCCTGCAGAGCCTCACACTTCTCTTTGAGTTCGTGCACACTGCGTTCACTTGCTTCTAGCTGAGTGGAGGTGTAACTAAGCTGCGTCTGCACA
GAGCCAACGATCATGTCGTGCTGCCGCTGTGCTGCGCTCATACTGCCTTCGTGACCCGACACGAGCTTGGCTTCTTTGCGGCCATACTCTTGTTGGGCAT
CTTGGAGCTGCTTCTGCAGCTTACCGATTTCTTCTGCTTGCGTTCTGCACAGCATTTTAGTAACTTAGCACGACCATTTCCATTACTAAAAGCAATGAGT
CGCCTACCTTAGTGTGAGTGTTGAGCGATGTACTTCGTTGTCGAGAGCATACTTGACCTCTTCCAGCTGCGAGATCTGCTTGTCTTTCTGCTCCGTCTCC
TTGCTTCGCAACGTCTCCATGTGCCCCATTTTCTCGCGCACAACGCCATTTTCGCGCTCGAGAGCAGTGCGTGCGGCCCGGTACTCTTCGAACTCTAGCT
TTCTTCGGTTCTCGAGTTCATCGAGCTGCATTCGCAGTTCATGGACGTCGCGCTTTGCATCGATCTCACGCTGTTGATACCGATCCCGTTCTTCTTTGGT
CATTTCAGCGTCTTTGCGGACCTGCTGCAGCTGCGCCTCGAGCTCTTCCGTCGTCTCCACCTGAATGGCAACAAAGCTCATCATTAGCCCTCGCCATCTA
ATAGTAACAAATACTTCGTAGTATGTGCACCATATCTTACCATTTTCTGCAGTTCTCGCTTGCCTAGATTCCTCTCTAGCTCGAGCTCTTCTTTCTCCGC
CAGAACTTGTAGTAGCAGTTGGTCATCCCGAGCAGCTTTATGGATCGAATTGTTGGATTCGACATCTTCATCGGGTTGGCACGACGCATCTACGGCCAAA
GGTGTCTGTCTTCCCGAGAGCGCTCGATTCCTTGTCAACAACTCCTCAATTTCGTCCACGTGCTTTAAGCTGCTATTGTTCCCCATGAGCTCCAGTGTCA
CGAGCGAGTGGTTGCTCTGCAATGCCTCACGAAATGAGAGCACGCCTGGGTTTCCGACCTCATTCCAACGCAAGTCCAGTTGACGTAGTGAGCGGTTAAC
TCTCAAAGCTTTTGCCAGCGCCTTGGCACCCTCGGGCCCAATGTTGTTGTTGCGCAAGTCGAGCGTTAGCAACCGTTTATCGACCTCCAGCGCACCGGCG
AGAGCTTCCACCCCCTGATCCAGCAAGCCAACATTATTCCACTCCAGACTGATGGCCACCACATTGTGCGACGAACGAAGCAGCGCCGCAAGCGCTCGGG
CAGCCCCAGCTTCGAAGCAATTCCCTCTCAGATCCAATCGAGTCGGAACGCTCGCAAGCCGAGCCTTCTCGACAATCTCCGTGAACTTGTCGTCTCCCAA
GTACAAGTTGCTGTAGTCGAGCACTGCGTCAACGGGCTGTTTGAGGTGCACAAGGGCTACAGCCTCCGAATCCTCGACGAGACACTCGCGCTTCGCTGGG
ATCGTCATGCTTGTGACAAGAGTCGTTTCGTTCAAAGCACCCGCGATCTTTTAGATCCGGAGCCTGTTCAACCTGTACATGAAGCTGCTCGTTACTGAGG
ACACGCTTGTCTCTGTAGTGCGTATGGCCGACACTGCTCTAGTCAGAAGCTGGAGTCAGCGTGGTAAAAACTTCACCATGCAGCCGGTTGCTGCAAAACG
ACTGATCAAACAACGGACGGCTTAACATATTGCACAGCTCGAACATGTACTGATATCCCCACGTGGTTGGCAGCTAAATATGTGTGGAGCTTACCCAGAC
GCTTCCAACTCAGTCGATTTGGGTTGCAGTCGATTGGTCCTGGTCATCAAAATGTAGCAACGCCAGAAGTTAAGTCCCTCTAGTACTAGCCGAGCGTTGT
CGATGCCTGAAAACTACTAGGACAGGCGAAAGCCCTTCAAACATGGGCGCCACGAATGAATTTGAAGTTGCAACGGGCACTTGGTTTGCAACACGCACGC
CACTTATACTACACGTGGATGAAAGCACACTGGCATTCACATCGAGACTCGCTGGTGAAGATCATGGGATGTCTCGCCACCTGGGGCTCTGGCGTGCGCT
TACAGCACACTGCTGTTTCGACTGTCAACAGCATTTGCCAGGGCAACTGTACAGGTGGGGCTTGGAGGATCTCCCAGATGTACATGTCATTGCCAGCCGA
ATAATACTGCTTGGTTGTCGGGTATTGCTCTGCCGTTCGTTACTACACGATGCAAGAATCCACCTGATAATTATAGGAGTCCAAAGCTGGCAGCCTCACT
CTCGAAAACGCCGCGTAAGTGGTGAAGTCTACTTTCTAGTTCATAATGGCCCCCGTCACCAATGCTCCTCTGACGCTGCATTCGCGGATCCAAGAAAGTT
TTGATGGTCTCCAGTGTGTGGACCTGGTGGAGTGTGCTGCCTCCGGGCGCCTATTTGTCGACAAGCACACCCTCCTGACCTCCTCCACCAGTGAAGGTCG
TAATGCTAGTGCTGCGGCATTGAACGAATTGGACCTCCACCTTTCGGTTCGAGACGCCGAGAACGTGGTCAAGCTGGAACGGCATTTGCTGCAAGGAGAA
AGACTCCACCTACTGCATGAACACTGCGCCCGCGGCGACCTGCTTGAAATCATGCAGCAAGAACTTCGCCTTCAAGCGGCGGGCGTGCCACCTCACAGCT
CTTCGATGATGACCTGCACTGACGCTGGGAGACGCCGTGTTTTCACTGCCGTGCTTCGAGGTGTGCAGGCTCTCCACTGCGCTGGAATCGCTCACTTGGA
CTTGTCACCGGAAAACGTCTTCGTCACAGACTCAAGCGTCGCGAAAGTCGGGGATCTGGGGCACGCCCAGCGATTCAAGCACGAGCGACCAAGCGTACAG
GTCGTACAAGCTGCCAAGGAAGCGTACGCTGCACCGGAGCTGCTAGCTCGCAAAGACGTGGAAGATGCACGTCAAGCTGATGCCTGGGCTCTAGGCGTCA
TCCTGTGGACAATGTGCACCAAGCGTGCTTTCGTGCGTCGCGCGTGTACTGACAGCGACCAGTTATTCTGCCGCATGACTGAACGAGGCACTGCGTTTGC
TCTCCAGGAGACTGGGCTGCTCTCCCAGATGCCGGCCGCGATGGTTGACCTGTTGGCTGGTCTCCTCGATGTGAACCCCAAATCAAGACTTACGGTGAGC
GCAGCTCTGCAGCATCCGTGGGTGAAGCAGGAATCTGCAACAAGCAAGCAGCAGTCTCGACGCAAGTCCATCGGCAATATGTTCAAGAAGAAGGGCGAGG
AGCTGATGAAGAAGCACCAGCGCCCGACCGAGAAAAAGTCGCGAGGTCGCACCGCAAGTACTGAGATCGCACTCGAGTCTACGCGTGTGGCCTTGACGTC
CCGAAATCTAGCTTAGAAGCCGACTAGCATCCACTCGTGTCTAGCACTAGAACACGCTTATAAGCGCTCTTTACGAGCGCAGAGCCCAACTATAAACGGG
ATAACATGAAACGAACGACTGCCATCGACGTTGCCCCTCTAAGCCGTCGCGTCCGCTTGATCAACTCCAGTCGCAGAGGAGCCCTCGAAGCTGTGCTATC
TTTCGACGCAGCTTGGTAGCATCGAGACGGGTGCAGAGCTTCGATGCGTCGACACTTCCTCTTCGCCGAGGATGAAAAGGAACGTAGTGTTGGGGACGGC
AAGGCCAACCTGCTACGACTATGGCACAATCGACGAAATGCGATGCTGGAAGGTGACGAGTCCGCCGACGGGGGTGAAGCGAACAACGCGTTAGTTGGTC
GTGAATTGACACTGCTTTGGGATTTAGCCAAGCCCCTGAATTCACGTACTTTGCAGCGTGACGGATACGTTGAGTTTTTCGCTCGAGCAGGAAAGGCACT
GGTACTTCCGTTGTCAACCGATGCGATTGCGATCCTCGCGGCTCGACGCGACTGGGAGTACGATTTAGAAGGTGTCGGCAGCGTCAATGAGTCTACCAAA
GCAGCTTCAAGTCTGGACGCTGAGGTCATGTCAGCCGTGCAATTCCGCGAGGCAGTCATGCAGCTCGCGGAGATTATCTTACCGGTTGAGAGTGCACCCA
GCGTTTTCGCGGCCTTCTTTCGGGATCTACGCAATTCTGTAGCGGAACTCGCTGCCTCTCCTTCAGGCAGAGAACCGGAGCAAGATGAGACCAATTCCAC
TGAGCCGGTTGACCGCTTCACGCTTCGACCATTGAATCGCATCCCGAAAATTGCGAATGACGCGTTCCTGCAAAAGCTACCGCCTTCGAGCGAGGCCTTA
CGAAGTATCCGAGGGCTTCAATCTCCTGACCAGCGTGAGATGTCACTCAAGCAGCTTCTTCTGTGCTACAACCCACGAAAGTTTTCACTCACCCGTGCGT
TTTCCAAAAAGAAGGGCAGTGACACCAAAGTAGCAGAGGAAGCCAAGGCAGATACCGTTGATACTCCTCAGCCCGATGTCGAAGACGAAATGGCAGTGGC
AAAACGTTTGCATCTGGAGCTCATGGGCTCTATTGGTTCGGGGGCAACCCCCGTCCGAGGAAGAAAACTCCACCGTGAAACTGCAGCACATCGGAATCCC
GAGGATGCTCTTATTGCAGCTCTGACCGAGTTTCCTGCACTAAGAATTGCAGTGGTGGGGCCACCTGGGTGTGGCAAGACTCGACTTGCCCGTGTGCTAG
CTCAACGACTTGGACTAAGGTATTTGTCACTTGATGGGGTTATTCAGCGCGCGGTTGACCACAAGCTCCGCATACGTCGACGTCGACCTGCCGTCATTAT
CCCTGTAGAGGGAGAGGACTCAGCTGTGGAGACACCTCTGGAGATGGAGACGGTGGAGGCAGACGAGGAAATCGATACTGACAACGCTGGAGAGGACGAA
TCCATAGACCAGGTTTTTCGAGATGAAGATCTCGATGCTCTTTGTGCTGGAGGTGTGGTTACTCGGAGCAAGGCACTGGATCTGTTTCGACTGGAAGCCA
CTCGTTCTTTACTCGGTACGTTCTGCAGCTTTATCGATGATGAAATCAAAGCGAAACTCACTATTTATTCCCTTCTTGTAGCTGGCGTCGGTGTGATTAT
GGACGATGTTTACCCGTGCGAACTTTCAATTTCAGATAACCCAGGGCACAGCATAGCAGTAGACTACTTGATAGCCCTCACAGCACTTCCCACCGAGATA
GAGCACCAATTGCAAGGCTCACAACTAGCACCAGCAGCGGGCCGTCTGTACTCAGTACGAGAACTTGCCACTTTGAAAGCAACACACGCTGAGGGGTTGG
TTGCTGAAGGCTTTGCCGATTGTCTACAACCACCGAAGAAACCGGAGGTTGATGCCGAAGAAGTGCAGGAGCCCAATGGTAGTACTGCAAACGGTGATGC
CGGAGCTAGTAGCGAAGACCAAGAAGTCGACGAATCTCCTTCTCCAGAGGAAAATGATGAGGAAGGAGACGGTGGACAAGTTCTATCAGAAGAACCTGTA
CTACCACCGGAACCAACTCCTGCCGAACGCAACGAGATCGAACCTCCCGGAGAACGCACGTTGCCGTTTGGTTCAATAGCGATGGCAAAATTCACCAAGG
GATACCACGAATACGTGACGCGAATGCAGCGAGAACTTTTAACACGTCGAGTTGCTGACTCAACGGAAAAGCGATCGGATTGTCATTTGGTGGTGGCTCT
GTCAACTCAGTCTCTCAACGTGATTCGAGACCACTGCATCCAGACGATCACGGGTGTAAGTAGAGATGCCAATAGTTGTGCGCTTGTTTTTGGTTTCTTG
ACATTCGGCGTGCTTGTATTTTGGTGCTGTACAGACGCCTCTAGGCCTCTCGCGCTTTAGTACGTCGCGTGAAGCTTGTCAAGTATCTCTGCCGGAGAAT
TTAAATGGTTCCAGCCGCGCTGAAAAAGTGAGGTGGCTACTCTACGGAGATTGGGCCGCGCTTCTTGAAGCCGAAGCAAGCTCCACCACCGAGTCGTTCG
CAAGACTACCAAGACGTGATGCAAAACGCCGATTGCTCTCGAAGTGGCGAGAGTTTTGTCCTGTAGTCTCGACTTCTGTTGGTGCTCTGACATTAGGCGA
TCCTGAGTTTGCAGCATGCTACTCCGGTCGGGTCTACCTGCTGGCTTCACAAGAAGCACGGCGTGCCTTCTGCGCATATCCATTGCAATTCTTGCTTCGA
GAAATTCCAATTCCGTCCAAGTGTCGGAACTTCTGGCTCGTAACCACAGGTGCAGGGGATGCCTTCACGCCCTCATACCTAGAGGCGCTCGAGGCTGGGC
TCCATGTGCAGACCGTGAGTACTTCAAAGCTGCTCAAGACTTCACCCAGCATAGCGATGGAAATGCGTCTCATGAGCGGACAAATTGTATCCCCCGTGGA
AGCTGCAGCGATAGCCTCCGATGCTGCCAAAACGTTGCTGGCGAAACAAAACGCGTCTTCTGGGTGGATGCTCATGGACTTACCGCTTACGCGTGATGTC
GCTGCCGCACTGCTCGAACACGGATGTGTCCCCGATGCAATATTGCTGCTGGACAGAGAGGTCGCCGCTGTTCAAGAAGATGGCGAAGGAAGTAGTGCCG
CCAACATGAGTGCTTTATCTGCACTGCGACGTCAACAGTTCCAGACTGAAAAGGCTGGCGCTGAGGACGTTTCACAAGGAATTGGAGGTGTTACTCGGGT
GATAACGTGTCCATTGTTCCGTCAGCCGAGTGACACATTGGCAGCCATCGAGCGAGAGCTTAATCCAATCGCACCACGTTTGGACAGGATCGAAGACGGA
CATGCTCCAGAGCTAGTTGATGAGTACGACCCAACTGTCATATTTGCCTCACCACTACCGGAAAATGACGAAGTTAACGAAGGAAAATCAACATCAACTT
CAGAGGAAGGAGATGAAGTCGATGTCACCGACCCTGAAGCGGAAGCTCAAGCCAAAGCAGCAAGAAGTAGAGCTCTGCAGCTTCAGGGAGAGTGTGGACA
TTTTTGCCCCGTGACTTGGCACACCCGTGGTTTGTTGATACCTGGACTGCCAACCAACGTTTGCTTGTTCCGCCAGAAGTTCTATGCCTTCGCTGGAGAA
CAGGAGCGACTTGCTTTCGAGCGAAATCCAGCAACCTTCATCCCAAACGGGCCTCGGTCAACCACTAATTTTGTACCATGCGTATTGGTGCTTGGTGTTC
GAGGATCCGGACGCGGCCGGGTCACTGCGGCACTTGCTAAGTCTCAATCGGATTCCCTCGTGGAATATCTCAATCTGGACTTGACCGTTGTTGCAAATAG
AGCAGAACGAAGACGATTGCTAGAGGAGCTCAAGCCGGAAGAAGCACGCATGACTTCAGAGGAAATGTTTGTCGAATCCCTTCAGCTCGAGCTTAAACGT
CAAGAACCAACACCCAAGAAAGCTGTAGCGCGGATTATCGCTGGACTGGGGTCAGAACCGTCACGCATCCCAACCACAGCGATGCTGGAGATGTGTTTCA
AGCATGGACTCGTTCCAGCACTTGTGGTTCCGCTGACAGTGTCAGAGGATGACGTTGTGAACACCTTGTTAGATCGATGGGCTGCCAGCTTACCGACACC
TCGCCGAAAGCTAGCTCTCATGCGAAAGAAAGAGGCTGGCGCTGAAGGTGAGGACGATACTGTCCCCGAAGACGAAGCTGAGGAAGAAGAACCACCGATC
GACCTGGAAGAAGCACGGGAAGAAGAGAGTACTCGACTGCACGAACAATTTACGGAGGACCAGAAGGCTCTGGATGAGGCTATCGCTGGACTCCGAGCGC
GAGGTGTCAGGACCTGCAACCCGATAGACGCTTCCGGCGCTTCAAGACAGATAATCAAAAACGTAAGACGCCTCCTGAACGACTTTATGGCAGGACGGGA
GACTCTTCTTGAGCACTGCGAAGTGATCGACATGGCAGCGGGAGGCACAATGCAGCGGCTACTAGCATCAGGAGAACTTCTTGTTGGCAAACATGGAGCT
TCCTGTCCCGTGACAGGACGTACTGATTCCTTATCGGTTGCCTCTGTGAAAGCTGTAGTGCATCGAAACCAGCTTTACTTTCCACGGTCACGCGAGGCAC
GTCGTGCTTTCGTGGCTTGTCCGTCACGCTACTTGGATAAGCCTAGTCTTCCACCAATGCATCAATTGACATGTTGTGTGGCAGGAGCTCCATTTTCAGG
CAAGACGCGTGTCTCCCAGGAACTTGCAAACGCACTTGGACTGGTCTACGTATCTCCTCAAAACGCAATCGAATGGGTGATGCAGTGTCAGGGTGGATCG
GCACTGCGGCATCGGCTGCAGGAGATCACAAACTTGCAGCATGACCCGCTTAATGATGCAAGTGTCACGCATGAGGTTATATGTGCTCGTCTTCGCTCTT
CAGAGTGCCAGACACGTGGTTGGGTTCTTGACGGGTATCTATTGCAGCGCCATAAGCTGCAACGCAGTCTTCCACATCCGGATTCGACAGAGGCTTCATC
ACAATGTATTCAACCGGACATGCTCTTCGTTTTAGAGTGCAGCTTCCAGAGTGTTTGGAAGAATCACCAGACTCACGTTGACAGGAACGAGCTTCGAGTG
GCATTTACACAATGGCATCAACACCGTCTAGAGCTGCTAGGCGTTTGGACGCGAAGCTATGGTTGTTTCCACGTTCGGCAACTCGACAGCTCCAGCAACT
CGCTCTGGAACGTAGCTGCACAAGCACAAATATTTCTCGAAGAGCAACAGCAGTTGGCATCACACCACACGAGGGCGATGGCATCCGGTCGAGCTGCCCG
CTCATTAGGTGTGGTGCGCACGGATGAAGAACTTCAGGGGCGCCAACACAATATTTTTCAGACGTTCTGCCCTGTTGAGCTGCAGGCAGGGAAGTTTTAC
AACTCTCGCCAATCAAGCCGTGACCTATGCGTCGACTTCCGAGGCTGCAGTTTCTGGCTTGGAAGCGAGCAAAACCTTGAGCAGTTCGTTGACAACCCTG
AAGGCTTCGTTGGGTATTTACCTGAACAAACTCCACTTGAACGGGGAGAAGAGTCGTGGCCAACGCAAGAAGACGCAGAAAGCGAGGCACAAACTCTTGT
CGCAAAGGCACCAGTGAACGCTTCGCTGGTGAGTCTGCTCACCGTGCCGGACTGTGACTTCCCTGAGATGAAAGGCTATTGCCCCGTCACATTCGCGTTG
GGCTCGGGCGACAAAGATTGGGCTTCACTCCGTCACGGCAGTGTTTTCTTCCGCGCATCGTACCGCTCAAAAGTTTACTTCTTCGTCTCGGAGGAAGCAC
GGCGTAAATTCTGCGCTGAGCCCTCTCGATACGCGTCACAAAGTCTGCCGGTCAAGTTACCACCCCAGGTGGCACTAGCCAAAAGCTACCCAGGTCAATT
GGAGCAGAAACTTGGTGCTGCACTCAACGAAGTACTGCTAGCGCTGGGTTGTGAACGTCCTAAGTTCCCGCAGATGCCGATGCGTGCTTCAGCATGCGTA
TATCTCGCCCTCTCACTCAAAGCCCTGCAACGCAAGTACCAACTGAAAGTAAAGCCTGACCCACGCTCAGCTCGAGACGAAGACGAACCGGACGAAGAGC
AGAAACAACGACAGGAACGGAGAGAAGAGCAGGCCGAGCGGGATGCGACCGCGCGCCGTGACGCCTTCGTGCGTGACTGCCGACTTGGGGAACAACTAAA
AGTTGCTTCCACTCCGACACACACATCTTGTGGCTCTGGTGCAAAGGTTGCACGCAGCATGCGTGCTGCACACGACTCACTGGCAGGCAATGAAACGGAG
AGCTACATCTCACCAGCACCTGCCAACGAAGAAGTTGATCAGCTTCGCCACCGTTTCGATGCTATTGTCTCCGGGAGCAGCAGTGCCGATAAAACGCTAT
CAACAGACCCTCGCTCAGCACGAACACATGCCAGAGCTGCATTCCTCGAGTACATCAAACCTTCTACAGCAATTTAGCAAGATCAGAAAGATGACGAACT
ACACTTCAGCGTATGCATCAAACAAACCTGTTGAATTTGAACAAGTACATGCATATCTACCTTGTCCTTCGTCTCAGCGCAGCAGAGGTGTCGACTCGGT
CACGTCAATTGCCACATGATCCTGTTGCAGGCCCCAGTTACCACCGAAAGGTGGCTTCCAAAGGTTAAGCAGAAGTGAGAATAGGATCACGGGCACAGAC
GAAAGCAGCTCCGACAGACCAGCGAGGGCCGGGGGGATCCAAATTCCAAGGGGCCCATACAGCGCACCGCAGGCCACAGGCATCATGAGCAGATTGTACA
TGAACCCCCAAGCGAAATTGTGCTTAATGCGTCTGTTGGTTGCGCACGAAAGCGCTCGGGCATTCAGTAAATCGCGCAGATCGTCCTTGACGAGCACGAC
GTCGGCAGCATCGAGGGCAACATCCGTTCCGGCCCCAAGCGCCACACCGACATCAGCTGTGGCTAAAGCTGGTGCGTCGTTCACACCGTCGCCCACGAAA
GCTACGCGCAGGCCAAGACTCTGGAGCAAGCGAACCTTGTCCACCTTTTGATGAGGCAGGGTTTCAGCTAGCACAGAGCCTTCGGGCACGCCTAGCGCCG
TCGCCACGCTCATCGCTGTTCCACGCTGGTCGCCTGTTACAATCCATGGCTGAATGCCCTCGCGCTTTAGCTGCTCGATAACACGTTTGGCTTCCGGGCG
TGGAGTATCTCGCAGTGCGATAGCAGATAGCAACTTGCCATTAACAGCCAAGAAAACTACAATGCACCCTTGTGATTGGAAACGATGATTCGCCTCGATG
AACTCGGCATGGACCTGCAGAGAGCCTGAGCCACCGTAACTCTGCTGCTTCAGCCACGTGAGTGAACCGAGGTGTACCTCAGCACCATTCACAGTGCAGT
GCACACCACATCCCGGGATGGCCTCAAACGCTTGTGCTTCGTCGATCTGAGATGCTTGAAGCCGAGTCTGAGCATGGGCAACAAGTGCTTTCCCGATGGA
GTGCTCACTGCCGCTCTCTGCTGCAGCCACAAAGCGCCAGAGCTGGTTTCCATCAAAATCATCGTGTGGAGTATAGAATACACCAGCAACCCCAAGGCGT
GCTGTAGTGAGTGTCCCCGTCTTATCAAAGACGACCGCATCAACCTCTTCCAGCGCTTCAAGTGCGCGACCACCCTTAAAGAGTACACCGACCTGCGAGC
CTTTTGTTGTTGCCACCATCACTGCAGTTGGGACTGCGAGACTGATGGCACAAGGGCAACTAATGACTAGCACCGTGATCGCGAAGCGCAGCGCAAACGG
AAAAGGAGACCAGCCTTGCGTATCCACGTGTCCATGCTTAGCGAGCGAATACCAAAGCATGAACATACATCCGGCCAGAATGATGATGAACGTGGTGAAG
TATGCAGCCACAGCGTCCGCGATACTTTGGCGCACACCACGCGAAGCCTGAGCCTCCCCTACAAGACGCACCATTCGCGCCAGCATAGATTCGTGAATGG
TATGCGTCACACGCATGGTCAGGACACCTTGCAAGTTTATGGATCCACCAATTACAGTCGCGCCGGGTTCCTTGGGCACCTTGCGAGCTTCACCCGTTAC
CATCGACTCATCCACAGAACTGGCACCTCCCACAACCACACCGTCCGTAGGAACTCGCGTACCGGGAAGCACTTTCAGCAAGTCGCCATGCTCCACAAGC
ACCACTTCAATGTACAACTCCTTCTGGTCTTCGCCCTCAAGCAGAATTGCAGTTTTTGCCTGCATGCGCAGCAACGCATCAACACTGTTTGAAGCACGCG
CCTTCACCAGCGTCTCGATGTATCGACCAACAAGAATGAGAGTAATCAGGAGCACCGTGACTTGAAAAAAAGTCTCCGTCTTCACTGGTGTTTGCTCTTG
TGGAGGCAATGAGGGCTCTTGCACCAAAGGATCCACCTCTACAACATTAGATGCTTGATACTTTGCGATCGCTTCTGTCGCAACTGTAAAAACAGAAAAC
GCGTAGGCAGTGCAGGCGCTCAGCGAGATGAGGACGTCCATAGTAACGCGTCCGCCGTAGCGCAGCGCAAGGAAAGCACTTTCGTGAATAGGGAATGCCA
CAAGGAACAACGCTGGGGTCGCGCACGCCAACTCCACAGCGTCTCTGATGCTCAAAAGATTCGCGGTGCCCCAGACTGCTGCATCTGCTAGATTAGTGTC
GGAGGAAAAGAACGCTGGTAGCACAAACTCGACGAAGATCACCGGCAATGACAGCAGACAGCTCCAGAACAACAGACGCGTAAAGCGCCTCACTTCTTCC
TCTCCTGCGCGGACCGATGGCGCCCGCGGGCTTGAGGCTTGAACGGTGAATCCAAGCTCGTGCGAGAGGTGCCGCACTATTTTACGAGCACCCGTGATAT
CCGGGTTGTACTCAACCAGCAACGCCTTACTTGATGGTCCCGACGAAGCTGGTGGCTCACTAACATCTTCAGCCGAAGCGACACCAGCGACCTCAAGAAC
CAGTGTTTTGGCTCGTGGCACGATTTCAGACTGCCCAAGGTGTAACACGATTCCCACGACGTCGTCACCAGAGAGCACACTCGGTTCAAATCCCAAGGTG
GCTACGGTCTCTTCGATAGCCTTCGCCGTCACTAGCTGCGGATCAAATTGAAAGACGCCCCGACTCGTAAGCAGGCTCACATTCACGTCCACAACACCAC
GCTGTCCGGCCATGAACTTCTCGATACGCGTGCAACAGCCGCTGCATGTCATGCCACTGATGTTGAGGCGGAGGCTCTCCAAGGACTCGGTCGTGTTACT
CTTCCTACCCGAGATTGACCGGGTCTTCTCGAGAGTAGCCCCACGATCGTTGCGGAACTGCACCAAGCGTTTCAAGAAGCTGGGAGATCGCTCCGGAAGT
GACAGGCCCTTCGCATTCGACGAGCAGCAACCATCGGATCGTGTCTTAGACGCATCGGATGAGCAGCAACCAGACGTCTTCGGCTCTTTCGTAGAAGCAC
AAGAGCCGTTGGCTTTGCCCTCCGTCTCGCCATTTGCAACCTTCGACGAACAGCAACCAGAGTCACTTGGGGTCTTTGACGGCTTCGACGAGCAGCAGCC
AGACGCCTTTGTCTTCTCCGTAGTAGTACAACAATCATCAGACTCGGTCGCAATCTCGGCAGTCTTGTTCGACGAGCAGCAACTGGAATCGTCAGTGGCC
TTCTCCTTGTTTGACGAACGACAGCTCGACTTCTTCGGCTCTTTCGAAGCGCAGCAATCGTCGCGTTCAGTCAATACTTGCGGTGCCTTGGACGAACAGC
AACCAGCACCACTGGACTCGCCAGCAGCGTCCGACGGGAAGCATCCAGCCTTTTTCTCCACCCCCGAAGAGTCAGCCTCTGCAATCTTCGACGAGCAGCA
GCTCGGAGGTTTCATTGTCTGCGCGTCCACAGCCACCTCGCCTTCTCCCCCACAGCAACCGTCAGCACAACCCGTTCCGCTCTCCGTCTCCTTTTTCTTG
CTGCAGCACGAAGTCTCGCACGTCTTGTCTGGCGACTCCTGGGTTGTGTCGCTGGCCTCCTCACCGCTGGAGGAACAGGACGCTGACGTCTCTCCGCCGT
CGCTCTTGTCGCAGCAGCCTTCAGTGTCCACGGGGCCCGCTACCGCGAGCGCTCGACAGCCGTTGCGTTTGCCCATTGGTACTACTTGTCCAGCGTGCAG
CGCGTTGAAGTCTGCGAGTTTGGAATCGACTTTTCAAACATAACGCAAAAGTTAACTTGCAGCAAGCGCAACTTGAAATTAATGCAGCACAACTTAAACG
TACAGCAACGTAAGCAGCGCAACTTTATTACGAATCATTGTGTAATCGAACCGCAAGACCGGTTAGCGGGTAATTGTAACCGCTGAACCGTGCTGACCTG
GTACATTGTACCATATGCATGTACGCCACACCAACTTGTGGTTGGCTGTGGTTTGCTCTGCGCCAAGTCGTCTGCACCCGGCACCGCTCAGTTCTTTTCA
GACAGGTAAGACACGCAAGTGTGTGGGTTGGACGCCTCAACGCCTCCTGACCTAAGTGTTGTGCTTGTTTCCTCAGGTATATTCATCACCATGCCCGCTA
CCAAGACGCAGAACGTGGTGCTCGCCCGCGGCATCAACGCCATCTCGGCCAACAGCCTCTCGAAGAAGAACGGCCGTGGCAAGGTCGTCAAGAAGGGCGG
CGACAAGAAGGTCGTGGCCAAGAAGGCTACCACCACCAAGAAGTGGTACCCTGCCGACTACATCCCGAAGCCGCTCCAGTCGGCCAAGACCAAGCGCAAC
AGCGTCAAGACTGCCAAGCTGCGCAAGTCCATCACCCCTGGCTCGGTCCTGATCCTGCTGTCGGGCCGTTTCCGTGGCAAGCGCGTGGTCTTCCTCAAGC
AGCTGGCTTCGGGCCTGCTGCTCGTGACGGGTGAGTTGCAAGTCTCTCTTTTCGGCAGAAATGGAGTGCACAAAAGTAGCGGCATTCCGATGATGCAAAC
TTGACACTTCGAGAGGCACTCTGCCGTCCCCTTCCTACGTTCGCTTATACCCTCAAGCTTCGTACTTCGGCGCCTCATCCCGATAGCTTCCTTGTATGAG
GTCTGGCTATTGGTGCTTTGGCTCGGGGTATGCGGAGCAACGCTGAGGGTCTAGGTGGATGAAGAAGGGGTGTCTTTTTGCCAAAGATCCATCAGATTAT
GAGACCTGAGGAATGCCCGCTCTAGATCTCCTGCCTTGTGCGAGTTGATGTTGCTTTGGACGCAATTGCTGACATCAGATTGGGATTATTGATGTATTTC
AGGCCCCTACAAGGTCAACGGTGTTCCCCTTCGTCGCGTGAACCAGTCGTACGTGATCGCCACGTCGACCAAGGTCAACATTGAGGGTCTGGAGCTCCCT
GCCATCGACGACGCCTACTTCGCCAAGGAGAAGGCTGCCAAGAAGACCAAGGAGGAGCAGTTCTTCGCCCAGTCGAGCGCCGTAAGTGCTTGTTTTCACT
CTGTTGCTATCCCCTGCCGTTCCTTTGGTCGGTTTTTCGAGACCACTACAAACAGTTCGTCCACATCCAGCAAGGAAGTTGTTCTGCAGTTGGAGAAAGA
GATTGACGAACCCTTTGGGATCTCTCTCTATCTCTGGTTTCAGTGCTCTTTCTTGTGTGGCGAATTGGGTAGGAGGCGTGGATGTCTTAGACGTCCATAG
CTTCTTATCACATCATATGAGCGCTTGGGATCGCTTGCTTCGGCACATAAGCTCCCTATAAGACACTGACCATGTTGGTGTTATTTCTCTCAGGCCCCCG
TCATCTCGGAGCAGCGCAAGAAGGACCAGAAGGCCATCGACTCGGCTTTGATCAAGAAGCTCGACGCCGAGCCGTTCCTGAAGGCTTACCTGAACGCCAA
GTTCTCGCTGACTAAGAACGACCGCGCCCACGCCCTCAAGTTCTAAGTGCGCTCTTGCTATCCTGTGTAGCAGTGTGATGTGCGATGATTGAGATAAGAA
CAGCAACCAATATACCTGATGAACTTATCACCAAACATAAGTGTTTGTGTTGCATTTACCCTAGAATCTCATCGAGTAGATCTTGGAGTTGGGTGTTCTC
GCTTTTGCCTTCTTGTAATTCGTCGTCGTCGCTGTTTTCTTCCGACGAGCATTTCCTTGTCGAATAAAGACCGGTGCTCTCACTGTTGCCTTCATTTACA
AGCGTGTTGTAGCTAGAGCTCTTTTTCACCCTGAGCGAACCACCGCTGGTCTGAATGGAACCAGTGCATTTTGCATCTGCTATCTCGCCACGAGCACTGA
CAAGCGAAGAGCCCCATTCTTGGTGCCGTGCGTGTGCTTGGTATCGCTCTTTGGCTGTCCACTCTCGTCGCGATGACATGGCACCGCCACCAGCCCAATG
ACTAGCAGGCTCCACAGCAGATACCGGAATTTCCTCCGACTTTTTCGAGCACACACTTGTCCTTCCAGCATAGCTAGAGTAGCCTCCTATAGTTTTGTGG
TCGCTCCGTAGCGGCAACACGGGCACTTCTTCCTCGTGCAGCACTAAAGTAGGCACCGCAAGCGTTGGCCGTGCCAATGGCTGGTCGAAAAAGCGGTGTT
GAAGGGCTTGCGCCGCTGTGAGACGTCGACTCGGGTCAAATTGCAGTAGGTCTTGGACAAGTTGAACCGCTGTGGATGGTGTGCCGGGCGGTAGAAATCG
AGTCCAGGACACAGGAGAGCACTTGGGGAAACGCATCTGCATATGAGAAGACATCGCTGCACCTTCAGGCCACGTCTCCTTGGTCGGTGTTCCTAAAACC
TTGCAGATGCGGTAGAACTGGTCAGCCTCTGACGTCCCTGGGAAGAGCGGCGTACAAACCAGCAGCTCGACCATGATGCATCCGCAGGCCCACATATCAA
CGGGGCTGTTGTACGTTGTTGAGCGCAGTAAGAGCTCTGGCGCGCGGTACCATCGCGTAGCCACGTAGTCTGTAAACGGCGGTCGCGATCGAATTTCGCG
TGCTTGGCCCAAGTCAGCGATCTTGAGTGTATCATTGTGACACAACAGGTTCTCAGGCTTGATGTCGCGATGGAAGAATCCGTGCTTGTGCATGTATGCT
AGGCCACTGAAGAGCTGGTACATCATCGAACGGATCTGTGCCTCTGAGAACCATGGATGCGGGGGCACCGAAGATCGAGATGAACTGGTAGCATCAGAAT
TTAAGCTTGGATCGCCTCCAGCACCACTTGAGCTGGAACTTCCGAGAGTTTTGAAGTTGCGCATGACCCGAAAAAGTGACGTCTGCATGTACTCGAACAC
GAAGTAGAGCTCCTCCTTGTCTCGAATGACCTCTTTTAGAAGCACGATGTTTTCATGGCGAAGCACGCGCAGCGACTTCAATTCGCGTAGCTGGAGACAC
TCCTCCCACGTGGGGAACAACGCCTTGATCTTCTTTACAGCGACTATTTCATGGGTCTTGACGCTACGCGCACGCGACACTTCCCCGAAAGCGCCGTCAC
CAACTCGGTCCAGCATTTCATAGCGGTTCATCTTGGACCTGCTCCTCAACCCCAGCAATGTGAATAGTAAGGCACCCTCTGCACCTATAAACAAACACAA
ACCAGTAACGATAATTGCTAGAAAGGTCAAAATCCTTTCGTGTTGCTGACGCGGCTTACACTGGTTCTATGATGATTTGGTGAGCTTGCCGTAGCTTTCG
ATCATCCAGCGGAGTGTGCGTGCTACCGTATCAATGTCGACTTTGTGGAGCGCACTGTGTAAACAAGACAAATCATGGTTAGATTTCCGTTGAAGAAGTA
GAGAAGTATGAAGGCGGGCGCAGTTATACCTGACAGGGAGTACAGCTAGATCGGTGGTCTGGCGCAGCTTGTTGAAGTTTTCTTCCGCGCCTGCATGATG
CCAGAACAACGTCAGAGTGAGGGTGCTAAGCACTCACAGTAAATGTTCCTCCCGTACCTTGCTCATCCATCTTGTTGGCAACTATCAGGGACGGACGCGA
CGAGATTCCTGGAGCATACAGCTCCAGCTCTCTTTGAAGATGAGTGAAGTCCTCGAGGGGATCACGTCCCTCCGAGCCCGCCGTGTCAAGCACATACATT
AAAATCTGTAAAAACACCGCACACACACCATGGTTAGCTCATCGCCCAGGTAGAGGAGACAGATCAATGATACACACACACCTTTGTGCGCTCGATGTGG
CGCAAGAAATCGTGACCAAGACCAACATTGCGGTGTGCACCGTCAATAAGTCCAGGGATGTCAGCCACACTCAAGCGGAACGTGTCTGGGAACTCCACAA
TTCCCACGTATGGGTGAAGCGTCGTAAAAGGATAAGGTGCAATCTCAGGCGTCGCACGGCTGAGAACGCTCAACAGCGTCGACTTGCCCGCATTCGGGTA
GCCTACAAGACCCACATCAGCGATGGTCTTGAGTTCCAGCTCGTAGTATTGCGAGGTACCCGGGTGACCCGTCGTCTTGTTCTCCGGCATGTGCTTGCGC
AGCCGTCCGAATTTGGTCGTCTTGCCTGCCAGGATGCGGTTACCCAGTCCAGGCTTTCCGCCCTTCGCAGCAAGGAACGTCGCTCCAGGCTCGTCTAGAT
CACACACCACTTCCATCTGGTCCACAATCTCGTACTCGCCATTCTCCAGTTCGCGCTCGTAGCGCTCCACGCGCTTGACGAGTGTACCACACGGCACCTT
GACGTGGCAATGCTTGCCTCTCCTTCCAGCAGAATCATTTGCTGGACGCCAGCCACGCAAGAGTCAGTACCCTGAAAAAGTATTTGCAGCACACAAATGA
ATCCCATGCACGTACCCATGCCGTTGGTGCCGGCGCCTCCCCTAAAGTGGTGCGTGGCGTTCGCCAAGTTCTGCATCTTGTCGGAGGCTTCGATCAGGAC
GTCTCCTCCAGCACCGCCGTGTCCGCCATTTGGTCGCTTGCGCATGGCCGACTCGGCGAAGAAACTGGCGCAGCCATTGCCTCCGTGGCCGCCCGTGGCC
TTGACGCGGATGCGGTCCACGAAGCGGCGCTTGGAGTGCTGCGCGCGTCGCACGCGCACCTTCTGCTTGACGTGCTCCTCGACCTTG