Description :
From Genome Similarity Track
Location :
Scaffold_301:4419- 6224
Transcript NameFunction/comments
Phyci_168027Hypothetical protein
Phyci_175289Hypothetical protein
Phyci_174513Hypothetical protein
Phyci_256353Hypothetical protein
Phyci_256310Hypothetical protein

Sequence
1805 bases(100 bases per row)
gagttctctgcatcctccaaaccttgccacgatacCTCCAATTCCCAGCGCGACAGCTCGTCATTGTAGCGCGCGCCGCAGAATCGCTCGACGTTGGGGA
GAAGCCCTTGATTGGAGACATGCtgcatcatttcctcagtgatatcgaggcttgagtcagcgtagaatttcaaacgggaaccgtgtacatcatgacgggc
tttggtgatgagatGTTCAATGATGAACGAATGCGAGAGGGCATCAATCACCTTGAAAGGCCCGACCCAACGGACCATGAGTTTATTCCCTGGTAGTCGA
GCATCCACTCGAGACCATAAAACAAAGTCTCCTTCCGAAAAGTTGCATGGGGCCCCTTTCTTTGCTGCCATTTGCTGTAGTTGACGGCGCTCACGTATGT
CCGCAACCTCTTTGTGCATTCCTGGAGGCTGCGGCGTAGCTCATCAAGGCGCTTCACAATGGACGGCTTGCTCAGATCGACCGCAATCGGTTCGTCGTCG
TGGCTGCGATGCGGATTCCTAATCACATCCAGTGCACTAGTAGGtggcaaccccgtgaaaagctccacaggagccttgtcacccaatgatggtagctccg
tgtggttcaaattagcttggactaccggaagcaagtatggccactccttcgtgtccagctgatactccataaggagcactctgagcacctgcaggacatc
gcggttcacacgctcaacagtgccgttgacccacggactgtacggcggcgtgaagccctgcttgcttttcaaccggctgctaagcagattcaacaccgag
ttgcgaaaatgggtgccacagtcagactgcctggtctccggagatccgaatcgcttataccagtccatgatggcttcagcggctacgaacgcagtcgggg
aactgcaagcgaccaactcgcagaaatgcgtcaaatcgtccttcaacacgagTACGTAGCGCAGGTCCCCAGGACTTGGAGTCAATGACAAAAAGTCCCA
GTGCAAAACCTCATTACGTCTGCTGCACTTTAGCGTAGGTccccacgggcgctgaattacatgcggtccctttacgtgcttgcacaatagacacgttctc
acgaaTCGCTTGATAATACCAGTGGCATCATCCAATGCAAAGCGACTCATTGCGATCAGCATTGCCTGCTCTCCTCGATGTCCTTGGGAGCCAGCGTGGG
CTACGACCAATATGCGAGCCAACAAACGCTTTGCTGCTGCAGGAATCCACGGCTTGCCGTCAACACACACCAAACCATCCACCACTGTGTGGTCAGGTGG
TGCTGATCGTACATGCCTCTGCTGAGCGTCAGCAAGACTTTCGTTTGAAGGCCAGTCAAACGCGCTGTCCTCCAATGGTCGAAGCTGCGAGATTTCTTGC
GCGCTGCGGGTACGCACAAAGTTAATCTTCTTCACGGACTGACTGCCGTCCCGCACATGCCACCACCTCGACACGATGTCCGCCCATAGGTTATTCGCTC
CGGGAATATGCTCGATTGTGCAGATTCACCCAGTTAGACGCATGGCCCAACGCTGCAGCTTCGCCTTGACATGTCTCTTGAGCTCTTTGTCCGGGGCAAA
AATCGCGATCAAGTTCGCATGGTCACAGTATAACcgaaacccatttgcacgctgcagtaaataatccagtgtagtgcatgcttgcacaattggaaacgct
tccttttcaacgatactccagttggcctgtgagtcgcgaaacattccccctttgcacaccagcaactgatgctgttgctcatggatggcgagtcattctt
ccagt