Description :
From Genome Similarity Track
Location :
Scaffold_135:44183- 46477
Transcript NameFunction/comments
Albla_Nc14079780myosinlike protein putative

Sequence
2294 bases(100 bases per row)
TCCCGGGCTGAAATGCTACGTTCCAGACAACGAGGATGTCTGGCTGGAAGCAGAAATTGTAAAAGAAGAGAACGATGGAAATTCACGCAAGATATTCGCA
AGAGTTTCACTGCCAGATGGAACGGCTGCAGATCGTGTCGTAGACCTTGAAGACAAGAAAATGAAATCGATTCTTGCATCTCAGCAACTGACATCATTGC
CATATCAGAATGAGATGACAAGTGCGTTTGGTGTGGAAGATATGATCACGCTGAATTACCTCCATGAACCAGCCATCTTGTTCAATATTAAGGCACGATT
CTTGAAGAAGCTTCCCTATACATACACTGGAGACATCTGTATTGCTGTAAATCCGTACCAATGGCTTCCCGAATTGTATGAAGAAGAACAGCATTTGCGA
TATGTGAACCAGCCGAAAGAAGAGCTTCCACCGCATGTGTATGCGACCTCAGTTTCCGCTTATGATAATATGATGCGAAATAAAAAGAATCAGTCCATTT
TGGTGAGTGGAGAATCTGGAGCAGGGAAGACAGAGACCACCAAGATTCTTATGAATCATCTGGCAACTATTGCAGGAGGGCTAAATAATTCCACAATCAA
AAAGATTATCGAGGTCAATCCGCTTTTGGAGTCTTTTGGGAATGCCAAAACAGTCAGAAATGACAACAGTAGTCGATTCGGCAAATTCACACAATTACAA
TTTGATAAGAAAGGAACACTGGTCGGTGCCAAGTGTCGAACCTATTTACTAGAGAAGACACGAGTCATACACCATGAAGCTCCGGAGAGGAATTATCATA
TTTTTTACCAGGTAAGCTGCCCAGTAATCTCTATCGGAACCTTCGATTTATCGTCTTGTTCCAGCTGTTGGAATCCGGAGACGTTGCTCAAAGGTTGGCT
CTTGAAGCGTCCAAGATTTACAGATACACAGGGAGTAATGATACCGCTAGTATCGAAGGCGTCTCGAACGCGAACCATTTTTTACGGACGAAAAACGCCT
TGAGTCTTATCGGAATGAATGAAGAGAGTCAAATGGTTTTATTTGAGGTGCTAGCTGGGATCTTACACTTGGGCCAGATTCAGCTGATTTCAGATCCAAC
TGATGATGAGAAATCTCTTATCACAAGCGGTGACGAAGGAGCTACTTCCACTACAGAGCTCCTTGGGGTCACATGGGAACAGCTAGAATCTGCGTTATGC
TCTCGAACCATGAGGGCTGTCAATGATGTATATAGCGTTCCATTGCGTAAAGATCAAGCAATGGATTGTCGTGATGCACTCGCTAAAGCTATTTACTCCA
ACATATTTGACTGGCTTGTGAAAACGATCAATCAGTCCCTTTCCAATGACGCGAATATGAACAACCACGTTGGCGTACTGGATATCTTTGGTTTCGAACA
TTTCAAGCACAACTCATTCGAACAATTCTGCATCAATTATGCAAATGAAAAATTGCAGCAGAAATTTACGCAAGATGTGTTCAAAACTGTTCAGATTGAA
TACGAAGAAGAAGAAATTGTTTGGGATCACATCGAGTACGTTGACAATCAAGACGTGTTGACTGTGATAGAAGAGAAAATGGGTATCATATCTCTTCTGA
ATGAAGAATTGATGCGTCCGAAGGGTAATGAGGAATCCTTCATGTCCAAGGTCGTATCTTTACACAAAGAAGATATGAGTCATGTGATCGAATTTCCACG
AACTTCCCGTACACAGTTCCTAATCCGACATTACGCAGCTCCGGTTCTGTACGAATCGGTCGGATTTCTGGAAAAACATAAAGACGCGTTGCTTCCGGAC
TTGTCCGAGCTCATGCGTGGATCCTGCAAGCCATTTCTATGTGAGCTATTCAAGCCGATTGAAAGTGAGAAATCAGCTCAGTCAGGTCGCAAACGTGGTG
GAGGAGCCTTGACACTGACTACTGTTGGAACTCAATTCAAAGAAAGTCTTAAAGAGCTCATGACAACGATACAGTCGACTAATGTGCATTACGTGAGGTG
CATCAAGCCCAATGCGATCAAATGCTCAACGACTCTGAATCACGAAATGGTTGTATCTCAGTTGAGGTGTGCAGGTGTCATTGAAGCCATTCGAATATCT
CGTGCAGCGTATCCGAATCGACTTCAGCATGAAGAGATTCTTGATAAGTTTTGGCTGTTTGTGCCGGAAGGAGGAAAGACCCCACAAGATCGATGCAGAC
TGCTTATGGAGCATTTGGAATTGAAAACGCCCGAGCAGTATCAAATGGGGAAGAGTAGAGTCTATTTCCAACTTGGGGTACTTGAAGAATTAGA