Description :
From Genome Similarity Track
Location :
contig_31:441805- 442832
Sequence
1027 bases(100 bases per row)
GGCGGACCACGGGCGACTGCAGTCCGGACGGACCTCGCCAACCTGACAAAGACCGGGGCTGCTTGGAGAAGGTGTCGATGGGCGAATCAGGCTACTGTGA
GGTGGAAGACGCAGTATCGGGCGAGCGATTCCGAGTAATGCAGAGACACTGCAACTCCATCCGACAGGGGTACCATTTCGCTGTTCGGACGCTCAAAACT
TTATCGATTTTCGTGTCCAAATGTACAGCAAGATTAACGAAGCGCTCGCACCCAATTTTACTCTGCCGAATGTCGTCAAAACGGAACCTGCACCTCGTGA
TGGCATCGTTATGGTAGTCTACCCTAAGTTACTCGCGAGTGCGTACGCTACCATTCGAGTCTTGCGGGATGTCTTGGGGTGTCGGTTACCTATCGAGATT
TGGTTCCGACCGGATGAAGTGAAGCTGAACGATGGAATGCTCGCACCACTGCGGCACCTAGCTTCGACAGAGTCCAATATCACGTTCCAAGAGATCAGCG
ACCCGCAATCGAAACGATTTTTCGCGAAAGTGCACGCCATTTACCACAGTTTCTTCGATCGCGTACTCTTTCTGGATGCCGACAATGTCCCCGTGCGAGA
TCCTAGTTTCTTGTTTGAGTCTCCTGAGTTTATCAAGACTGGTGCGATTTTCTGGCCTGATTTCTGGCACCCACGCTCCACACTGTTCAACATTCATGCC
AAGTCGTTGCTGTGGGAATTGCTAGACATGGAGTCCGTCGACATGTTTGAGCAGGAAAGCGGCCAACTCGTTGTTGATCGCCGACGACATGCGGCTCCGC
TGGAGCTCGTGCAGTTTTTCGCCTTTCACCGACCAGACTTTTTCTCCTTGCTGAAGCTTGCGTGGGGAGACAAAGATTTATTCCGTTTCGCGTGGCTAAA
GCTTGACGTTCCCTTTTTCATGGTCCAGACGCCGCCCGGCATGGCTGGAATGGTCATCAATGGCTCGGAGTTCTGCGGTATGACAATGGTTCAGCACGAC
GCGGACGGAGAAGTGCTCTTCTTGCAC