Description :
From Genome Similarity Track
Location :
contig_38:441714- 469962
Transcript NameFunction/comments
g7155.t1hypothetical protein PHYSODRAFT_343735
g7156.t1U4/U6 small nuclear ribonucleoprotein Prp31
g7157.t1hypothetical protein PHYSODRAFT_293746
g7158.t1hypothetical protein PHYSODRAFT_293746
g7159.t1hypothetical protein
g7160.t1hypothetical protein
g7161.t1hypothetical protein

Sequence
28248 bases(100 bases per row)
TGGTACGACTGCTGCGCCGACTTCTCCAAGTCACCGTGGTTCTTCAAGTTCTTCATGACGTTCAACGTGCGCGACTGGGACGGCACTAGCTTAGCCGGCG
AGTAGTTCTTGCTTGGCTCAAGAGGTAGGTCAGTCAGCTGGTTCAATAGGGTCGTTTCAAACTCGGACAGGATAAGCACACCCTTGCCCTTCATACCAGC
ACGCGCCGTACGTCCAAGGCGGTGAATGTACTGGTCACGGTCAGTGAGACCCACCTGGAGCACTAGCGACACATCCGGGTAATCTACGCCACGCGCCGAC
ACGTCCGACGAGAACATCATGACCTTGTGGCCCTTACGGAAGGCCTCAGCCGTCTTCGTGCGCACCGCTTGACTCTTGCGTGAGTGAATCTCAAGCACAC
CCGGGAAGCCCGCGGCTTGGAAAAGCTGGGCCATGAACTGCGCCGAGCGAGCGGTAGGGAAGAACAACATCACCTTGTACGCCGGCAACTTCATGTGCGC
AGCCAGCACGTGCTCCATCATGGGGACCAATTCCTTCATCGAGCACACAATGTACTCCTGCTCCGTCTGCGCGTTCGTGTCAGCCTCGTTCTCGTCGATC
GTGTCTACGAACGCGTAGTCCGAGCGCAGAGCCACACGCTTGAGCTCCTCTGTCGAAGCAGGCAGTGTGGCGCTGAACAGCAGCGTCTGACGCTGCTTCG
GCAGGTAGCCAATGATGCGCATGACATCCGGGCGGAAACCCATGTCCAGCAGTCGGTCAGCTTCGTCCAGGATCAGCACACTGGCCTTGCCTAGTCGGTC
AGCGATCCTGCCAGTGTTCTGCTTCAAGTGGTCAACAAGACGTCCAGGAGTAGCGACAAGGATGTCAATAGGCGCGCTGCTCGTGAGCGTGCGTTCGTCC
TTCTTGATGTTGGCACCACCCACGAAGCAGGCCACGTTCAGCTCGTGGAACTTGGTGAGGCGCTTAGCCTCGGTCGCGATCTGCTGCGCCAGCTCGCGCG
TGGGCGAGATGGCAAGCGTTGGGATCGTGCCCTGGCGACGTCCCTCCTGCACCATGTTCTCGATCACCGGCAGCAAGAAGGCCATGGTCTTGCCGTTGCC
TGTCTTGGCCTTGGCCAACACGTCCTTGCCCTCGATGATGAGCGGGAACGTCTCGTTCTGCACGTTCGTGAGGCGCTCGTACTTGAGGTCTTCGACGATG
GCGCGCTTGGTCTGGGCCGAGATGTCCAGCGACGCGAACAGGACGTCCGACAGGTAGTCCAAGTTCGTGGGCTTAGAGGCCTCCACCGGCGCAGCATCAA
TGGGAGCAGGAGCCTCCTGCGCCACCGGGGCAGCGGTCTCTTGGGTCTGCTCGGAGTTCTTACTGCCGTTGTTGCGTCGGCCGCCGCGACGCGGGCGCTT
CTTCTTGTGCTCGGCGTCGCTGTCCTTGCGGTCGCCGGCGGGCGCCTTGCGGCGCCAGTTGCCGTTGTTGCTGTCGTTGTGGTCTTGGCCCGGCATCTTG
AGTTGACTTGGGTGCGTGCGTGGCCGCGGGAGAAAACTGAAGAGTGAGTTAAACGGCCACAAACCAACCGAAACGTGTCCTTTCGCGGGCAAGACAAGCC
ACTTGGCGTTTGTATGCTCATTGAAAACTACGATATGGCATACTGCGACAGTTTCTTTCCATTGATCTCCCGATCTTCCACTTCACAATATGCCACAACA
CAGTTACCTACTCATGAAAATCCAAACACAATTAATTTTAAATACTTGCAGACATGTCGACGCTGGCCGACTCGTTCCTGGAGGACCTAGACGAGCTCAG
TGGGGGCAGCAGCGACGAGGGGGAGACGCCCACGCCTGTAAACGCAGACGAAAAGGCCGAAGACGGAAATGACGCCGACGAGCTGATGCCCGATGCGTCT
CAATCGGCCAAGAGGAAGCGCCAAACGACCGAGGAAGAGCTGCCAGACGAGAAGACCCAGGACTTCGCTCAGGCGCTGCGCTCAAGCGTGAAGCAGCGCG
GCGTGGCGGCCGTCGCGACACTCAAGCGCTCACCCAAGTACCTGGCTCACGTGCAGGAGATTCAGCAGTTCGTGGACGTGGACGACGCAACAGCAGCCAA
GCCCCAGCAGCTCGAGGAAGGCAGCGCCGAGTACGACCTGGTGGTGACGTCCAACGACTTGATGGTGCAGATCGACGACGAGATCGAGGCCGTGCACCGC
TTCATTGCGGAGACGTACGCCGCCAAGTTCCCGGAGCTGGACTCGCTCGTACCGAACGCTCTGGACTACGCTCGCGTGGTCAAAGCTATTGGCAACGCGA
TGGACCTGACGCTCGTAGAGGAGCTGCCTAAACTGCTGCCCAGCTCCGCAGTCATTGGCATTTCCGTCACTGGGTCGGGGACCAGTGGCAAACCGTTGGC
CCCTGAGGACCTCAAGACGTGCATGGAGGCGTGTGATGAGCTGCTGTCGCTGGAGAAGGACAAGAACATGATCCTGCGCTTCGTCGAGAGCCGCATGAAG
TACTTGGCGCCGAATGTGTCGCAGCTTGTGGGCACTCGCATTGCAGCGCAGCTCATTGGACTTGCTGGTGGTGTCGCGCAGCTTGCGAGGATCCCGTCGT
GCAACTTGCAGGTGTTGGGGCAAGAGAAGAAGGTGTTGAGTGGGTTTTCTTCCGCTGCTGCATTGAAACATACGGGCGTCCTGTTCTTCAGTGACCTGGT
GCAGAGTATGCCCCCCTACTTGCGCATGAAGGCGTGTCGAGCTGTCGCTGGAAAGCTAGCGTTGATGGCGCGCGTAGGACAGCCAGCCGCACCAAAATGA
CACGGAAGGTCTCGTGGGTGCACGCTTTCGGACTGAGCTAGTTGGTAAAATGGAGAAATGGCAGGAACCTCAGAAAGCCAAGACGAAGAAGGCACTGCCG
ATCCCAGACGAAAAACCGCGACGTAAGCGCGGTGGCAAGCGCTACCGCAAGATCAAGGAGCGGCTGCAGATGACGGATGTACGCCGTGAAATGAATCGGC
AGTCTTTCGCGACAGCTGACGAAGAGTATGGTGACAACGCCATGGGAATCACATCCGGCCGCCTTGGCCAGGAAGGATCGGGCAATTTGCGAATTATGCG
CAAGGAACAGAAGCAGTCGAGCAAAAAGCTGCGTGCCGCGAACTTTGCTGCGTCGTCCGCTAGCAAGCCACCGCTTTCTGGATTGGCATCGAGTCTTGCC
TTCACACCCGTGCAGGGTATTGAGCTGATGAATCCTGAAGCTGCAAAGGCTCGTGTTGCGGAAGCCAACAAAAATACTTTTCAGCTGCTAGTGGGTTTGT
GAGCGTCGTCAAGAAGCCGTAGACTGCCGAGAACACTGTGATCAGCCTGAAAAGATGTTGTTGTCTTGCTCAAGTCAAGAAGATAATGATGCTCAAGGCA
CGAACAAGGGGAAACGAGCGGCTGAGCAATAAGAAGTTTTGGGTTTGACACGTTCGTGGTCGGTGCTTTTAGTGTCTGTCTTGCCCTGACATGGTACTCT
ACGACGCTGGTTGATATCTCTCAGGTCTATCTACACTGGCCTGTCGGTCAGCTCAGTGCCCTAAGATCTCGAACGTCGTGATCGATTGAGCTGGGAGACC
CGCACTGAGTCTGGCACTCTGGCCAAATACGATGTCGGTGCTGGAGGTTTTGTATACGGCTCCCGATGTTGTGTTCAGCTCCGTTGTCCAGATATTAATG
GGGCCCTCCACGTACGATAGAGCCGACAGATCAAACGTAATGGTCTCTACGTCACCCAAGTTCGTAGCCACGATGACCATCACTTGGGTAGCTTTGCCGT
AAGCAACGACGAAGTTCGGGTATTTATCCAGGGCGTACGACGAGGATCCAGGAATGAGCGTATTGAGGTCGTCAAACTTGAGGATGGTCATGCCAGCACG
GATATGACGCGAGTAGGGAACCATCACGTAGTGCTTCGGATTGGCCGTGCTGATTCACTGGTCACCTGGGTTCGACTGAATAAGCGCCACTACTCCGCTG
CCAAGAGCTTGCCTGTAGACGAAGGCCGATGCACCCATCTCATAAATGTCTCGAGCGATGGTCTCCGCTATGGTGACCAGAGGTCGAATACGTCGGCTCC
GCGCTTCGATGCCAAGCCAAGCATTGCTCGCTGCTTTGCATCCGCGTCCCAGTTCCAACTCTTTGGGTCAGCACGGACCCGACATCAGTCTAACCAGAAC
GTCTCGATTGCATTGAACGCCGGCATGTTCTCTGACGTCTTTATGGCGATCTCCGTTCCACTATCATCGATGACGTTATTACCGGAGCCGCCGATGTTGT
AGCGTGCGATGTTGAAATCGAGTGCTGGAATGTCCTCTGCGGCGCCATTAATGGACACCGACGACACGTTGGTGAAAAACACGTCGGCGATGTCTTCGCG
GTCTCCGAAGACGTTGGCCCACCAGGAGAGCGAGGTTCCCCATCCTTCCCAGGACTCGAGCATTGTCGTCGTCGTTATGAATCGTGTGACTTGAGAAGGT
TGGGCGGTTAAGAGTGCCCAGGCCAACGTGGAGCTTGCAATCGATGCAGTCGTGAACATGTTTCTTGGATGCAGTACCAGTATGCTCTCGCACGAAGCAA
AATGGTGAATGAAGAACGAGTTCGGTACATACCTGTATAAGCAGAGAATGAACCTGCTCAATCCGTGTACAGTTCGGTCGCTACCGCAATCTGCGCACAC
AGGAAGGGATAACGTGGGTTGCAGCGTGTAAGATGCGTGGATTACACGTTATCGAGTATAATAACGCTGCCTTGTTTTCTCGTCCAGACAGTAAAAGTCG
GCTGCAGTCTTGCCACGCGATCAGCTGGGGATCTGTGGATGCTGGGCATCTGCTTCGGGAACTTTCGACTACGGCGAAACTTGTATTAAATACATGTTGT
TCATGAGCCCACGACATCGGCATTCACGTGTGTCGATGCAAACTCGCTTGGTTTCCACATGTATCAAGTCGCAGACTCTGAGATTAAGACAGCATACGTT
GGAACAATCCCTTAGCATTTCATTTTTACGTTCATTTGGTTCCATCAGGTGCCTCCATGTTGCTCAAAGGAAGTACTCCTCGTACTTCTGCTCGTAAATG
ATGCAAAATCGTCGGTCGGGGGTGCGCCTAACGCGATGCAACGTGCCTGGGATGCGGCCTTCCGTGGCTCGATGCAGAGCATGACCACAGAAAAGCACAA
TCTCCTTACCCGGAACGCACACCTTCTCGGCCTTAAGCCACTGTTTGGAGTGAGGATCGTACACATCCAGTCCCTCCACGCTCGGTACAGGCTCCACAAC
ATACAGACTCGGATCGATATGCTCGAACACATTTTCCGTCTCGGACTGGCCGCTTCCTTCAATGTTCGGGTAGTGCAATCCGTAGCAAACCGAAAAGTCT
TTGTCCGATCGCGCACCACTCGGCTCAATATCATAGCCGACAGTCAAGCTCAATGCACGGTCGCAGATGCGCTGCATGCGGCGCTGCAGACCCAGCCAGT
GGTCCTTAAACTCTGGTGACGGCCACACCAGCCTCGACATGTCCCCGCAAGCCACTCGGAAGCAGTCACGCACACTCGTGTGCTCATATCCGCAGTACCA
AAACGGTTTGCCATGCTCGTTGCGGTACACGTGTTTGCTTGTGCATCCGTTCTTCCACTCGTCATCGTCGCTCGTGAAGAAGGTCTCAAAGTCCTGAAGC
ACTCGGTCGTGGATACGCTCCAGCGTCTCACCGAGCTCCGTGAGCACCACGAACGAGTGGCGCTCCATCATCTCCAGAAAGCGAGCGCGGTTCTTCCAGT
TGAGGTCACTCAGCCGCAGACGCGGCACTTGCACCGCATCGCCGGGAGTTTGTTCAACTCGTTTTTCGACGGTCTCACATGGCCTCTGGACGTCGACGAC
GACGTCGGTAATTTCGCCGCTTGCATTGAGGCAGTAGTAACTGGCTGCCAGACTGTAACCAGTCGGCATGGAGAAAGCCTGCAGCGGTCATGTCGGTGTT
GGCGCGGCGCGAGGATTAATGCACACGAATGGCTACGACTCCTTGGCCGTGTCTTTGCGTCAGAGAACCGGGGCCCCACGTTTAGTGTCCAATCAACAAA
AGTTCAAGTAGATGACCATCACTCTGGTTGTGCTGCTGACAGCACGCTACGGGCCCGGTTGCCTAGCACCGTGGAAATCGTTGGAGTGTACAAATCTACT
GATTGGTTTATGGTATAAATTAGCGCGGTGCTCGACACGAAGATATGCATGTCGACATGGCGAAGGGGGTACGCAGTGGAGGGACGAGCACCAGCAAAAG
GTTTACCGGTACACGCTAGGCACGGCGCCTAGACGTCAAGTATCTTCGAGACGTGGTTGCCTTTGTATTGGCCCCGTGCAACTGGTTGTCCTCCTTGTAG
TCGAACAGACGCGAGCGCACCTGATCCAGACGACCCTGCCACTCTCAGGCGTGCGCGGTCTCCGCGTCATGTTGCCAACGTGCTTGGTCTTGTCAGCGGC
CAGGTTGCGGTTGCGCTCCTCAAGCTGACGACGGCGTTCGAGGTTCCTGGCTTTTGTGGCCGCAAAGCGCGGCGAGCTGTCGTAGTCCATGTACCGAGGA
ACAGACGTCGAGATCGAGCGGCTTTTCGGAGACGTAACCACGGGTGGCGCACCCCGCGCCGATTCCGAGAAATGGCGCGTCGACTTGACGGGCGGCGCAA
TGGTTGCTGAGAGCGAGGAGCGACGAGACCTCGCGGGCGTTGGTGCTACTGGAGGCGGGTTCTTAGCGGCATAGAGGGAAGAGCGTCGCGACTTTGGGGC
CGAAGAGACTTTGTCCTTGGTAGTGGTGGACGGCGATTTGCCCGTGAGCGAAGCACGTCGATATGAGTTAGGCGGGACAAGCTTCGAGGTCTTTGTCGAT
TGCAGGTTCTCAGGGAGCGACGAGCCTCTCGAGCGGTAGACGGTGGGCTTGACATTCTTGGAGGCTTCAGCACTGGTCTCGCCTGACGCCTGCAGTAGAT
CAGGCAGGAAGATGTCGAGCGAGCTAAGAAGCGAGTCCAGGGAGCCCGTGGATGCAGTGGAGTAGGACGACGGGCTGGGAGGGACAGCCGAGTAGCAAGT
GGATTTGATCGTAGTCGTTGAGTCGGCATCGCTTTCGTCTTCGTAAGAGTTAAAAGTCATGGGGTCATACTCATTGTCGGACTCCAGCGTGTTGACTGTG
AGGCTCCTGTAGACCGCAGGCTTTGTCGGGGTCTCTGGCACAGCAACTGGGGTCTCCCCTCAGCAGGTTCCGTGACGTCCTCTGTCTTCTGCAATTGTGC
AGGCTCCGACTGAGTGCGGGTGCGTTGTGTGTTCATGCGCACGATGATTTCCTTCACCGGCGAATTTGGCTGCAACGGCAGATCCATGCGTTTAGATCCG
CCAACGGACCAGGAGCGCGGAGTTGCAGCATTGGCCTGCGCCATGAGCTCGAACCGGGCGATGAGAGTCTGCACACTCGAGGTGCTGTCCATTTTAATTG
CCTTTGTCTCGGTGGACGACTAAGATAGCGGCGAGAAGCGTTTCCGCGATGGGAATCTCGTTCGTGTGAGCTCTGCGGGTCCGAAGCGGAACTGGCAGCG
GTCGACACTAGCTGGCAGCGTTTTCGTGCTCGGCTTTCGGGGCGGGGCTGGCTCTTCCAGTCCTCTTTCTGGCGCTCGCTGAGCTCGTAACTCGTCGCAC
CCCAGTTGCCCGGCCAGTTCCGAACTGACCTGGCACAAAACGCTTGGTGCGGATGGCTTCAACCACGGGGCCCGCGCCGTTTCGACTTTCGCCAATCGTG
GAGCTTATAGCGCATTAATGGCCAGTAGTGAGCCGCGATATTTAGGCGGGATAAAGATCGCAGGTGATGTGTCCAGCGACATATGCTGCGACAAAAATTC
GATTTCCGGCCCATGCCGCTGCTAGCAACTCTGACATTTGATACTGTCGTATTTAGCAAACCATATAGACAAGCTATACAACAACGATTCCAAACATGAT
AACCTACTCTTCTGACATACTATGCTTTCCCGGAGGCCTAGTTTAAAACGGCCAATCAAATGAGGCGCGTCACATGCTCGCCTGGATCTGCTTCAACTTG
AGACCAAGTGTCAATTCACTGTCAATGAGGCCATGTATCACAGTTACCTGAGGCGAAACGCTAGAGCCGCTGGCGTCGATGGCCATGGGCGCAGCTGCAT
TGGCGCTCGAGGACTCGTGCGGGTCGATTGCTCCGGTGCCGCCGCGCCCTTTGCCGGCAAACAGGCTAGGCGTCGGACCTCAGCGCGTCGGAAGACCGTT
TCTTGCGGCGTTCTCGCTCCTTTGCGATTTGCTCCTGCACGAAACGGCCAAAGGATTCGGCCAGGTCGTCGATGCGCTTCTCGTGCTCGTGGTTCTGCGC
CGACAGCTCGCGCTCCAGCCGCAGCACGTGGCCTTCGAGCACCGCGATCGCCCCCGCCTTCTCCTTCAAGATGGTGGCGCTCTCCACCGCCGCGATCTTT
GCGCTGGCATTCAGAGCCTGCAAAAAGACACAGCAACGCATCAGTATGCTGGGCAGGAGGCTCTGACAGACAGCAAGCGAACGTACATGGATCCGTTCGT
CGAAGGTTGCGTGCATCTGCACGAGTCTGGCGTCCTGCTCTTCTAGCCTCCGGACCTGCTGCTGCAACTTCTCCTCGCACCGAGATCTCTCGCTCGTCAC
TGCGGCTAACTGCGCCTGCTTCTCCTGCAACGCCCTGGATTGCGTCTCCGTCGCGGCCTCGAACTCGCTCTGCTTTTCATCTCGGGCTTGCTGCAGCGAG
ACGTTGTCTTGTCGGAGCTGGATGATGGTCTCGAGGTGTTTTTCCACTTCTCGCTCGAGGTGCTGCCGCGCCTTCTTCACCTCGGCGACTTGGGCCTCCA
CCGATCCAACAGAGCGTTGGATGCGCTCCTGCAGCTCCGCCTCCCATTGCTGCTTCAGCTCTCCGACTGTCTTTTCGTGGCCAATTTGCGACTGCAAAAG
CTTGGCCTGCAGAGCCTCACATTTCTCTTTGAGTTCGTGCACACTGCGTTCACTTGCTTCTAGCTGAGTGGAGGTGTAACTAAGCTGCGTCTGCACAGAG
CCAACGATCATGTCGTGCTGCCGCTGTGCTGCGCTCATACTGCCTTCGTGACCCGACACGAGCTTGGCTTCTTTGCGGCCATACTCTTGTTGGGCATCTT
GGAGCTGCTTCTGCAGCTTACCGATTTCTTCTGCTTGCGTTCTGCACAGCATTTTAGTAACTTAGCACGACCATTTCCATTACTAAAAGCAATGAGTCGC
CTACCTTAGTGTGAGTGTTGAGCGATGTACTTCGTTGTCGAGAGCATACTTGACCTCTTCCAGCTGCGAGATCTGCTTGTCTTTCTGTTCCGTCTCCTTG
CTTCGCAACGTCTCCATGTGCCCCATTTTCTCGCGCACAACGCCATTTTCGCGCTCGAGAGCAGTGCGTGCGGCCCGGTACTCTTCGAACTCTAGCTTTC
TTCGGTTCTCGAGTTCATCGAGCTGCATTCGCAGTTCATGGACGTCGCGCTTTGCATCGATCTCACGCTGTTGATACCGATCCCGTTCTTCTTTGGTCAT
TTCAGCGTCTTTGCGGACCTGCTGCAGCTGCGCCTCGAGCTCTTCCGTCGTCTCCACCTGAATGGCAACAAAGCTCATCATTAGCCCTCGCCATCTAATA
GTAACAAATACTTCGTAGTATGTGCACCATATCTTACCATTTTCTGCAGTTCTCGCTTGCCTAGATTCCTCTCTAGCTCGAGCTCTTCTTTCTCCGCCAG
AACTTGTAGTAGCAGTTGGTCATCCCGAGCAGCTTTATGGATCGAATTGTTGGATTCGACATCTTCATCGGGTTGGCACGACGCATCTACGGCCAAAGGT
GGCTGTCTTCCCGAGAGCGCTCGATTCCTTGTCAACAACTCCTCAATTTCGTCCACGTGCTTTAAGCTGCTATTGTTCCCCATGAGCTCCAGTGTCACGA
GCGAGTGGTTGCTCTGCAATGCCTCACGAAATGAGAGCACGCCTGGGTTTCCGACCTCATTCCAACGCAAGTCCAGTTGACGTAGTGAGCGGTTAACTCT
CAAAGCTTTTGCCAGCGCCTTGGCACCCTCGGGCCCAATGTTGTTGTTGCGCAAGTCGAGCGTTAGCAACCGTTTATCGACCTCCAGCGCACCGGCGAGA
GTTCCACCCCTGATCCAGCAAGCCAACATTATTCCACTCCAGACTGATGGCCACCACATTGTGCGACGAACGAAGCAGCGCCGCAAGCGCTCGGGCAGCC
CCAGCTTCGAAGCAATTCCCTCTCAGATCCAATCGAGTCGGAACGCTCGCAAGCCGAGCCTTCTCGACAATCTCCGTGAACTTGTCGTCTCCCAAGTACG
AGTTGCTGTAGTCGAGCACTGCGTCAACGGGCTGTTTGAGGTGCACAAGGGCTACAGCCTCCGAATCCTCGACGAGACACTCGCGCTTCGCTGGGATCGT
CATGCTTGTGACAAGAGTCGTTTCGTTCAAAGCACCCGCGATCTTTTAGATCCGGAGCCTGTTCAACCTGTACATGAAGCTGCTCGTTACTGAGGACACG
CTTGTCTCTGTAGTGCGTATGGCCGACACTGCTCTAGTCAGAAGCTGGAGTCAGCGTGGTAAAAACTTCACCATGCAGCCGGTTGCTGCAAAACGACTGA
TCAAACAACGGACGGCTTAACATATTGCACAGCTCGAACATGTACTGATATCCCCACGTGGTTGGCAGCTAAATATGTGTGGAGCTTACCCAGACGCTTC
CAACTCAGTCGATTTGGGTTGCAGTCGATTGGTCCTGGTCATCAAAATAGTAGCAACGCCAGAAGTTAAGTCCCTCTAGTACTAGCCGAGCGTTGTCGAT
GCCTGAAAACTACTAGGACAGGCGAAAGCCCTTCAAACATGGGCGCCACGAATGAATTTGAAGTTGCAACGGGCACTTGGTTTGCAACACGCACGCCACT
TATACTACACGTGGATGAAAGCACACTGGCATTCACATCGAGACTCGCTGGTGAAGATCATGGGATGTCTCGCCACCTGGGCTCTGGCGTGCGCTTACAG
CACACTGCTGTTTCGACTGTCAACAGCATTTGCCAGGGCAACTGTACAGGTGGGGCTTGGAGGATCTCCCAGATGTACATGTCATTGCCAGCCGAATAAT
ACTGCTTGGTTGTCGGGTATTGCTCTGCCGTTCGTTACTACACGATGCAAGAATCCACCTGATAATTATAGGAGTCCAAAGCTGGCAGCCTCACTCTCGA
AAACGCCGCGTAAGTGGTGAAGTCTACTTTCTAGTTCATAATGGCCCCCGTCACCAATGCTCCTCTGACGCTGCATTCGCGGATCCAAGAAAGTTTTGAT
GGTCTCCAGTGTGTGGACCTGGTGGAGTGTGCTGCCTCCGGGCGCCTATTTGTCGACAAGCACACCCTCCTGACCTCCTCCACCAGTGAAGGTCGTAATG
CTAGTGCTGCTGCATTGAACGAATTGGACCTCCACCTTTTCGGTTCGAGACGCCGAGAACGTGGTCAAGCTGGAACGGCATTTGCTGCAAGGAGAAAGAC
TCCACCTACTGCATGAACACTGCGCCCGCGGCGACCTGCTTGAAATCATGCAGCAAGAACTTCGCCTTCAACGGCGGGCGTGCCACCTCACAGCTCTTCG
ATGATGACCTGCTCTGACGCTGGGAGACGCCGTGTTTTCACTGCCGTGCTTCGAGGTGTGCAGGCTCTCCACTGCGCTGGAATCGCTCACTTGGACTTGT
CACCGGAAAACGTCTTCGTCACAGACTCAAGCGTCGCGAAAGTCGGGGATCTGGGGCACGCCCAGCGATTCAAGCACGAGCGACCAAGCGTACAGGTCGT
ACAAGCTGCCAAGGAAGCGTACGCTGCACCGGAGCTGCTAGCTCGCAAAGACGTGGAAGATGCACGTCAAGCTGATGCCTGGGCTCTAGGCGTCATCCTG
TGGACAATGTGCACCAAGCGTGCTTTCGTGCGTCGCGCGTGTACTGACAGCGACCAGTTATTCTGCCGCATGACTGAACGAGGCACTGCGTTTGCTCTCC
AGGAGACTGGGCTGCTCTCCCAGATGCCGGCCGCGATGGTTGACCTGTTGGCTGGTCTCCTCGATGTGAACCCCAAATCAAGACTTACGGTGAGCGCAGC
TCTGCAGCATCCGTGGGTGAAGCAGGAATCTGCAACAAGTAAGCAGCAGTCTCGACGCAAGTCCATCGGCAATATGTTCAAGAAGAAGGGCGAGGAGCTG
ATGAAGAAGCACCAGCGCCCAACCGAGAAAAAGTCGCGAGGTCGCACCGCAAGTACTGAGATCGCACTCGAGTCTACGCGTGTGGCCTTGACGTCCCGAA
ATCTAGCTTAGAAGCCGACTAGCATCCACTCGTGTCTAGCACTAGAACACGCTTATAAGCGCTCTTTACGAGCGCAGAGCCCAACTATAAACGGGATAAC
ATGAAACGAACGACTGCCGTCGACGTTGCCCCTCTAAGCCGTCGCGTCCGCTTGATCAACTCCAGTCGCAGAGGAGCCCTCGAAGCTGTGCTATCTTTCG
ACGCAGCTTGGTAGCGTCGAGACGGGTGCAGAGCTTCGATGCGTCGACACTTCCTCTTCGCCGAGGATGAAAAGGAACGTAGTGTTGGGGACGGCAAGGC
CAACCTGCTACGACTATGGCACAATCGACGAAATGCGATGCTGGAAGGTGACGAGTCCGCCGACGGGGGTGAAGCGAACAACGCGTTAGTTGGTCGTGAA
TTGACACTGCTTTGGGATTTAGCCAAGCCCCTGAATTCACGTACTTTGCAGCGTGACGGATACGTTGAGTTTTTCGCTCGAGCAGGAAAGGCACTGGTAC
TTCCGTTGTCAACCGATGCGATTGCGATCCTCGCGGCTCGACGCGACTGGGAGTACGATTTAGAAGGTGTCGGCAGCGTCAATGAGTCTACCAAAGCAGC
TTCAAGTCTGGACGCTGAGGTCATGTCAGCCGTGCAATTCCGCGAGGCAGTCATGCAGCTCGCGGAGATTATCTTACCGGTTGAGAGTGCACCCAGCGTT
TTCGCGGCCTTCTTTCGGGATCTACGCAATTCTGTAGCGGAACTCGCTGCCTCTCCTTCAGGCAGAGAACCGGAGCAAGATGAGACCAATTCCACTGAGC
CGGTTGACCGCTTCACGCTTCGACTATTGAATCGCATCCCGAAAATTGCGAATGACGCGTTCCTGCAAAAGCTACCGCCTTCGAGCGAGGCCTTACGAAG
TATCCGAGGGCTTCAATCTCCTGATCAGCGTGAGATGTCACTCAAGCAGCTTCTTCTGTGCTACAACCCACGAAAGTTTTCACTCACCCGTGCGTTTTCC
AAAAAGAAGGGCAGTGACACCAAAGTAGCAGAGGAAGCCAAGGCAGATACCGTTGATACTCCTCAGCCCGATGTCGAAGACGAAATGGCAGTGGCAAAAC
GTTTGCATCTGGAGCTCATGGGCTCTATTGGTTCGGGGCAACCCCCGTCCGAGGAAGAAAACTCCACCGTGAAACTGCAGCACATCGGAATCCCGAGGAT
GCTCTTATTGCAGCTCTGACCGAGTTTCCTGCACTAAGAATTGCAGTGGTGGGGCCACCTGGGTGTGGCAAGACTCGACTTGCCCGTGTGCTAGCTCAAC
GACTTGGACTAAGGTATTTGTCACTTGGTGGGGTTATTCAGCGCGCGGTTGACCACAAGCTCCGCATACGTCGACGTCGACCTGCCGTCATTATCCCTGT
AGAGGGAGAGGACTCAGCTGTGGAGACACCTCTGGAGATGGAGACGGTGGAGGCAGACGAGGAAATCGATACTGACAACGCTGGTGAGGACGAATCTATA
GACCGGGTTTTTCGAGATGAAGATCTCGATGCTCTTTGTGCTGGAGGTGTGGTTACTCGGAGCAAGGCACTGGATCTGTTTCGACTGGAAGCCACTCGTT
CTTTACTCGGTACGTTCTGCAGCTTTATCGATGATGAAATCAAAGCGAAACTCACTATTTATTCCCTTCTTGTAGCTGGCGTCGGTGTGATTATGGACGA
TGTTTACCCGTGCGAACTTTCAATTTCAGATAACCCAGGGCACAGCATAGCAGTAGACTACTTGATAGCCCTCACAGCACTTCCCACCGAGATAGAGCAC
CAATTGCAAGGCTCACAACTAGCACCAGCAGCGGGCCGTCTGTACTCAGTACGAGAACTTGCCACGTTGAAAGCAACACACGCTGAGGGGTTGGTTGCTG
AAGGCTTTGCCGATTGTCTACAACCACCGAAAAACCGGAGGTTGATGCCGAAGAAGTGCAGGAGCCCAATGGTAGTACTGCAAACGGTGATGCCGGAGCT
AGTAGCGAAGACCAAGAAGTCGACGAATCTCCTTCTCCAGAGGAAAATGATGAGGAAGGAGACGGTGGACAAGTTCTATCAGAAGAACCTGTACTACCAC
CGGAACCAACTCCTGCCGAACGCAACGAGATCGAACCTCCCGGAGAACGCACGTTGCCGTTTGGTTCAATAGCGATGGCAAAATTCACCAAGGGATACCA
CGAATACGTGACGCGAATGCAGCGAGAACTTTTAACACGTCGAGTTGCTGACTCAACGGAAAAGCGATCGGATTGTCATTTGGTGGTGGCTCTGTCAACT
CAGTCTCTCAACGTGATTCGAGACCACTGCATCCAGACGATCACGGGTGTAAGTAGAGATGCCAATAGTTGTGCGCTTGTTTTTGGTTTCTTGACATTCG
GCGTGCTTGTATTTTGGTGCTGTACAGACGCCTCTAGGCCTCTCGCGCTTTAGTACGTCGCGTGAAGCTTGTCAAGTATCTCTGCCGGAGAATTTAAATG
GTTCCAGCCGCGCTGAAAAAGTGAGGTGGCTACTCTACGGAGATTGGGCCGCGCTTCTTGAAGCCGAAGCAAGCTCCACCACCGAGTCGTTCGCAAGACT
ACCAAGACGTGATGCAAAACGCCGATTGCTCTCGAAGTGGCGAGAGTTTTGTCCTGTAGTCTCGACTTCTGTTGGTGCTCTGACATTAGGCGATCCTGAG
TTTGCAGCATGCTACTCCGGTCGGGTCTACCTGCTGGCTTCACAAGAAGCACGGCGTGCCTTCTGCGCATATCCATTGCAATTCTTGCTTCGAGAAATTC
CAATTCCGTCCAAGTGTCGGAACTTCTGGCTCGTAACCACAGGTACAGGGGATGCCTTCACGCCCTCATACCTAGAGGAGCTCGAGGCTGGGCTCCATGT
GCAGACCGTGAGTACTTCAAAGCTCCTCAAGACTTCACCCAGCATAGCGATGGAAATGCGTCTCATGAGCGGACAAATTGTATCCCCCGTGGAAGCTGCA
GCGATAGCCTCCGATGCTGCCAAAACGTTGCTGGCGAAACAAAACGCGTCTTCTGGGTGGATGCTCATGGACTTACCGCTTACGCGTGATGTCGCTGCCG
CACTGCTCGAACACGGATGTGTCCCCGATGCAATATTGCTGCTGGACAGAGAGGTCGCCGCTGTTCAAGAAGATGGCGAAGGAAGTAGTGCCGCCAACAT
GAGTGCTTTATCTGCACTGCGACGTCAACAGTTCCAGACTGAAAAGGCTGGCGCTGAGGACGTTTCACAAGGAATTGGAGGTGTTACTCGGGTGATAACG
TGTCCATTGTTCCGTCAGCCGAGTGACACATTGGCAGCCATCGAGCGAGAGCTTAATCCAATCGCACCACGTTTGGACAGGATCGAAGACGGACATGCTC
CAGAGCTAGTTGATGAGTACGACCCAACTGTCATATTTGCCTCACCACTACCGGAAAATGACGAAGTTAACGAAGGAAAATCAACATCAACTTCAGAGGA
AGGAGATGAAGTCGATGTCACCGACCCTGAAGCGGAAGCTCAAGCCAAAGCAGCAAGAAGTAGAGCTCTGCAGCTTCAGGGAGAGTGTGGACATTTTTGC
CCCGTGACTTGGCACACCCGTGGTTTGTTGATACCTGGACTGCCAACCAACGTTTGCTTGTTCCGCCAGAAGTTCTATGCCTTCGCTGGAGAACAGGAGC
GACTTGCTTTCGAGCGAAATCCAGCAACCTTCATCCCAAACGGGCCTCGGTCAACCACTAATTTTGTACCATGCGTATTGGTGCTTGGTGTTCGAGGATC
CGGACGCGGCCGGGTCACTGCGGCACTTGCTAAGTCTCAATCGGATTCCCTCGTGGAATATCTCAATCTGGACTTGACCGTTGTTGCAAATAGAGCAGAA
CGAAGACGATTGCTAGAGGAGCTCAAGCCGGAAGAAGCACGCATGACTTCAGAGGAAATGTTTGTCGAATCCCTTCAGCTCGAGCTTAAACGTCAAGAAC
CAACACCCAAGAAAGCTGTAGCGCGGATTATCGCTGGACTGGGGTCAGAACCGTCACGCATCCCAACCACAGCGATGCTGGAGATGTGTTTCAAGCATGG
ACTCGTTCCAGCACTTGTGGTTCCGCTGACAGTGTCAGAGGATGACGTTGTGAACACCTTGTTAGATCGATGGGCTGCCAGCTTACCGACACCTCGCCGA
AAGCTAGCTCTCATGCGAAAGAAAGAGGCTGGCGCTGAAGGTGAGGACGATACTGTCCCCGAAGACGAAGCTGAGGAAGAAGAACCACCGATCGACCTGG
AAGAAGCACGGGAAGAAGAGAGTACTCGACTGCACGAACAATTTACGGAGGACCAGAAGGCTCTGGATGAGGCTATCGCTGGACTCCGAGCGCGAGGTGT
CAGGACCTGCAACCCGATAGACGCTTCCGGCGCTTCAAGACAGATAATCAAAAACGTAAGACGCCTCCTGAACGACTTTATGGCAGGACGGGAGACTCTT
CTTGAGCACTGCGAAGTGATCGACATGCAGCGGGAGGCACAATGCAGCGGCTACTAGCATCAGGAGAACTTCTTGTTGGCAAACATGGAGCTTCCTGTCC
CGTGACAGGACGTACTGATTCCTTATCGGTTGCCTCTGTGAAAGCTGTAGTGCATCGAAACCAGCTTTACTTTCCACGGTCACGCGAGGCACGTCGTGCT
TTCGTGGCTTGTCCGTCACGCTACTTGGATAAGCCTAGTCTTCCACCAATGCATCAATTGACATGTTGTGTGGCAGGAGCTCCATTTTCAGGCAAGACGC
GTGTCTCCCAGGAACTTGCAAACGCACTTGGACTGGTCTACGTATCTCCTCAAAACGCAATCGAATGGGTGATGCAGTGTCAGGGTGGATCGGCACTGCG
GCATCGGCTGCAGGAGATCACAAACTTGCAGCATGACCCGCTTAATGATGCAAGTGTCACGCATGAGGTTATATGTGCTCGTCTTCGCTCTTCAGAGTGC
CAGACACGTGGTTGGGTTCTTGACGGGTATCTATTGCAGCGCCATGAGCTGCAACGCAGTCTTCCACATCCGGATTCGACAGAGGCTTCATCACAATGTA
TTCAACCGGACATGCTCTTCGTTTTAGAGTGCAGCTTCCAGAGTGTTTGGAAGAATCACCAGACTCACGTTGACAGGAACGAGCTTCGAGTGGCATTTAC
ACAATGGCATCAACACCGTCTAGAGCTGCTAGGCGTTTGGACGCGAAGCTATGGTTGTTTCCACGTTCGGCAACTCGACAGCTCCAGCAACTCGCTCTGG
AACGTAGCTGCACAAGCACAAATATTTCTCGAAGAGCAACAGCAGTTGGCATCACACCACACGAGGGCGATGGCATCCGGTCGAGCTGCCCGCTCATTAG
GTGTGGTGCGCACGGATGAAGAACTTCAGGGGCGCCAACACAATATTTTCAGACGTTCTGCCCTGTTGAGCTGCAGGCAGGGAAGTTTTACAACTCTCGC
CAATCAAGCCGTGACCTATGCGTCGACTTCCGAGGCTGCAGTTTCTGGCTTGGAAGCGAGCAAAACCTTGAGCAGTTCGTTGACAACCCTGAAGGCTTCG
TTGGGTATTTACCTGAACAAACTCCACTTGAACGGGGAGAAGAGTCGTGGCCAACGCAAGAAGACGCAGAAAGCGAGGCACAAACTCTTGTCGCAAAGGC
ACCAGTGAACGCTTCGCTGGTGAGTCTGCTCACCGTGCCGGACTGTGACTTCCCTGAGATGAAAGGCTATTGCCCCGTCACATTCGCGTTGGGCTCGGGC
GACAAAGATTGGGCTTCACTCCGTCACGGCAGTGTTTTCTTCCGCGCATCGTACCGCTCAAAAGTTTACTTCTTCGTCTCGGAGGAAGCACGGCGTAAAT
TCTGCGCTGAGCCCTCTCGATACGCGTCACAAAGTCTGCCGGTCAAGTTACCACCCCAGGTGGCACTAGCCAAAAGCTACCCAGGTCAATTGGAGCAGAA
ACTTGGTGCTGCACTCAACGAAGTACTGCTAGCGCTGGGTTGTGAACGTCCTAAGTTCCCGCAGATGCCGATGCGTGCTTCAGCATGCGTATATCTCGCC
CTCTCACTCAAAGCCCTGCAACGCAAGTACCAACTGAAAGTAAAGCCTGACCCACGCTCAGCTCGAGACGAAGACGAACCGGACGAAGAGCAGAAACAAC
GACAGGAACGGAGAGAAGAGCAGGCCGAGCGGGATGCGACCGCGCGCCGTGACGCCTTCGTGCGTGACTGCCGACTTGGGGAACAACTAAAAGTTGCTTC
CACTCCGACACACACATCTTGTGGCTCTGGTGCAAAGGTTGCACGCAGCATGCGTGCTGCACACGACTCACTGGCAGGCAATGAAACGGAGAGCTACATC
TCACCAGCACCTGCCAACGAAGAAGTTGATCAGCTTCGCCACCGTTTCGATGCTATTGTCTCCGGGAGCAGCAGTGCCGATAAAACGCTATCAACAGACC
CTCGCTCAGCACGAACACATGCCAGAGCTGCATTCCTCGAGTACATCAAACCTTCTACAGCAATTTAGCAAGATCAGAAAGATGACGAACTACACTTCAG
CGTATGCATCAAACAAACCTGTTGAATTTGAACAAGTACATGCATATCTACCTTGTCCTTCGTCTCAGCGCAGCAGAGGTGTCGACTCGGTCACGTCAAT
TGCCACATGATCCTGTTGCAGGCCCCAGTTACCACCGAAAGGTGGCTTCCAAAGGTTAAGCAGAAGTGAGAATAGGATCACGGGCACAGACGAAAGCAGC
TCCGACAGACCAGCGAGGGCCGGGGGATCCAAATTCCAAGGGGCCCATACAGCGCACCGCAGGCCACAGGCATCATGAGCAGATTGTACATGAACCCCCA
AGCGAAATTGTGCTTAATGCGTCTGTTGGTTGCGCACGAAAGCGCTCGGGCATTCAGTAAATCGCGCAGATCGTCCTTGACGAGCACGACGTCGGCAGCA
TCGAGGGCAACATCCGTTCCGGCCCCAAGCGCCACACCGACATCAGCTGTGGCTAAAGCTGGTGCGTCGTTCACACCGTCGCCCACGAAAGCTACGCGCA
GGCCAAGACTCTGGAGCAAGCGAACCTTGTCCACCTTTTGATGAGGCAGGGTTTCAGCTAGCACAGAGCCTTCGGGCACGCCTAGCGCCGTCGCCACGCT
CATCGCTGTTCCACGCTGGTCGCCTGTTACAATCCATGGCTGAATGCCCTCGCGCTTTAGCTGCTCGATAACACGTTTGGCTTCCGGGCGTGGAGTATCT
CGCAGTGCGATAGCAGATAGCAACTTGCCATTAACAGCCAAGAAAACTACAATGCACCCTTGTGATTGGAAACGATGATTCGCCTCGATGAACTCGGCAT
GGACCTGCAGAGAGCCTGAGCCACCGTAACTCTGCTGCTTCAGCCACGTGAGTGAACCGAGGTGTACCTCAGCACCATTCACAGTGCAGTGCACACCACA
TCCCGGGATGGCCTCAAACGCTTGTGCTTCGTCGATCTGAGATGCTTGAAGCCGAGTCTGAGCATGGGCAACAAGTGCTTTCCCGATGGAGTGCTCACTG
CCGCTCTCTGCTGCAGCCACAAAGCGCCAGAGCTGGTTTCCATCAAAATCATCGTGTGGAGTATAGAATACACCAGCAACCCCAAGGCGTGCTGTAGTGA
GTGTCCCCGTCTTATCAAAGACGACCGCATCAACCTCTTCCAGCGCTTCAAGTGCGCGACCACCCTTAAAGAGTACACCGACCTGCGAGCCTTTTGTTGT
TGCCACCATCACTGCAGTTGGGACTGCGAGACTGATGGCACAAGGGCAACTAATGACTAGCACCGTGATCGCGAAGCGCAGCGCAAACGGAAAAGGAGAC
CAGCCTTGCGTATCCACGTGTCCATGCTTAGCGAGCGAATACCAAAGCATGAACATACATCCGGCCAGAATGATGATGAACGTGGTGAAGTATGCAGCCA
CAGCGTCCGCGATACTTTGGCGCACACCACGCGAAGCCTGAGCCTCCCCTACAAGACGCACCATTCGCGCCAGCATAGATTCGTGAATGGTATGCGTCAC
ACGCATGGTCAGGACACCTTGCAAGTTTATGGATCCACCAATTACAGTCGCGCCGGGTTCCTTGGGCACCTTGCGAGCTTCACCCGTTACCATCGACTCA
TCCACAGAACTGGCACCTCCCACAACCACACCGTCCGTAGGAACTCGCGTACCGGGAAGCACTTTCAGCAAGTCGCCATGCTCCACAAGCACCACTTCAA
TGTACAACTCCTTCTGGTCTTCGCCCTCAAGCAGAATTGCAGTTTTTGCCTGCATGCGCAGCAACGCATCAACACTGTTTGAAGCACGCGCCTTCACCAG
CGTCTCGATGTATCGACCAACAAGAATGAGAGTAATCAGGAGCACCGTGACTTGAAAAAAAGTCTCCGTCTTCACTGGTGTTTGCTCTTGTGGAGGCAAT
GAGGGCTCTTGCACCAAAGGATCCACCTCTACAACATTAGATGCTTGATACTTTGCGATCGCTTCTGTCGCAACTGTAAAAACAGAAAACGCGTAGGCAG
TGCAGGCGCTCAGCGAGATGAGGACGTCCATAGTAACGCGTCCGCCGTAGCGCAGCGCAAGGAAAGCACTTTCGTGAATAGGGAATGCCACAAGGAACAA
CGCTGGGGTCGCGCACGCCAACTCCACAGCGTCTCTGATGCTCAAAAGATTCGCGGTGCCCCAGACTGCTGCATCTGCTAGATTAGTGTCGGAGGAAAAG
AACGCTGGTAGCACAAACTCGACGAAGATCACCGGCAATGACAGCAGACAGCTCCAGAACAACAGACGCGTAAAGCGCATCACTTCTTCCTCTCCTGCGC
GGACCGATGGCGCCCGCGGGCTTGAGGCTTGAACGGTGAATCCAAGCTCGTGCGAGAGGTGCCGCACTATTTTACGAGCACCCGTGATATCCGGGTTGTA
CTCAACCAGCAACGCCTTACTTGATGGTCCCGACGAAGCTGGTGGCTCACTAACATCTTCAGCCGAAGCGACACCAGCGACCTCAAGAACCAGTGTTTTG
GCTCGTGGCACGATTTCAGACTGCCCAAGGTGTAACACGATTCCCACGACGTCGTCACCAGAGAGCACACTCGGTTCAAATCCCAAGGTGGCTACGGTCT
CTTCGATAGCCTTCGCCGTCACTAGCTGCGGATCAAATTGAAAGACGCCCCGACTCGTAAGCAGGCTCACATTCACGTCCACAACACCACGCTGTCCGGC
CATGAACTTCTCGATACGCGTGCAACAGCCGCTGCATGTCATGCCACTGATGTTGAGGCGGAGGCTCTCCAAGGACTCGGTCGTGTTACTCTTCCTACCC
GAGATTGACCGGGTCTTCTCGAGAGTAGCCCCACGATCGTTGCGGAACTGCACCAAGCGTTTCAAGAAGCTGGGAGATCGCTCCGGAAGTGACAGGCCCT
TCGCATTCGACGAGCAGCAACCATCGGATCGTGTCTTAGACGCATCGGATGAGCAGCAACCAGACGTCTTCGGCTCTTTCGTAGAAGCACAAGAGCCGTT
GGCTTTGCCCTCCGTCTCGCCATTTGCAACCTTCGACGAACAGCAACCAGAGTCACTTGGGGTCTTTGACGGCTTCGACGAGCAGCAGCCAGACGCCTTT
GTCTTCTCCGTAGTAGTACAACAATCATCAGACTCGGTCGCAATCTCGGCAGTCTTGTTCGACGAGCAGCAACTGGAATCGTCAGTGGCCTTCTCCTTGT
TTGACGAACGACAGCTCGACTTCTTCGGCTCTTTCGAAGCGCAGCAATCGTCGCGTTCAGTCAATACTTGCGGTGCCTTGGACGAACAGCAACCAGCACC
ACTGGACTCGCCAGCAGCGTCCGACGGGAAGCATCCAGCCTTTTTCTCCACCCCCGAAGAGTCAGCCTCTGCAATCTTCGACGAGCAGCAGCTCGGAGGT
TTCATTGTCTGCGCGTCCACAGCCACCTCGCCTTCTCCCCCACAGCAACCGTCAGCACAACCCGTTCTGCTCTCCGTCTCCTTTTTCTTGCTGCAGCACG
AAGTCTCGCACGTCTTGTCTGGCGACTCCTGGGTTGTGTCGCTGGCCTCCTCACCGCTGGAGGAACAGGACGCTGACGTCTCTCCGCCGTCGCTCTTGTC
GCAGCAGCCTTCAGTGTCCACGGGGCCCGCTACCGCGAGCGCTCGACAGCCGTTGCGTTTGCCCATTGGTACTACTTGTCCAGCGTGCAGCGCGTTGAAG
TCTGCGAGTTTGGAATCGACTTTTCAAACATAACGCAAAAGTTAACTTGCAGCAAGCGCAACTTGAAATTAATGCAGCACAACTTAAACGTACAGCAACG
TAAGCAGCGCAACTTTATTACGAATCATTGTGTAATCGAACCGCAAGACCGGTTAGCGGGTAATTGTAACCGCTGAACCGTGCTGACCTGGTACATTGTA
CCATATGCATGTACGCCACACCAACTTGTGGTTGGCTGTGGTTTGCTCTGCGCCAAGTCGTCTGCACCCGGCACCGCTCAGTTCTTTTCAGACAGGTAAG
ACACGCAAGTGTGTGGGTTGGACGCCTCAACGCCTCCTGACCTAAGTGTTGCTTGTTTCCTCAGGTATATTCATCACCATGCCCGCTACCAAGACGCAGA
ACGTGGTGCTCGCCCGCGGCATCAACGCCATCTCGGCCAACAGCCTCTCGAAGAAGAACGGCCGTGGCAAGGTCGTCAAGAAGGGCGGCGACAAGAAGGT
CGTGGCCAAGAAGGCTACCACCACCAAGAAGTGGTACCCTGCCGACTACATCCCGAAGCCGCTCCAGTCGGCCAAGACCAAGCGCAACAGCGTCAAGACC
GCCAAGCTGCGCAAGTCCATCACCCCTGGCTCGGTCCTGATCCTGCTGTCGGGCCGTTTCCGTGGCAAGCGCGTGGTCTTCCTCAAGCAGCTGGCTTCGG
GCCTGCTGCTCGTGACGGGTGAGTTGCAAGTCTCTCTTTTCGGCAGAAATGGAGTGCACAAAAGTAGCGGCATTCCGATGATGCAAACTTGACACTTCGA
GAGGCACTCTGCCGTCCCCTTCCTACGTTCGCTTATACCCTCAAGCTTCGTACTTCGGCGCCTCATCCCGATAGCTTCCTTGTATGAGGTCTGGCTATTG
GTGCTTTGGCTCGGGGTATGCGGAGCAACGCTGAGGGTCTAGGTGGATGAAGAAGGGGTGTCTTTTTGCCAAAGATCCATCAGATTATGAGACCTGAGGA
ATGCCCGCTCTAGATCTCCTGCCTTGTGCGAGTTGATGTTGCTTTGGACGCAATTGCTGACATCAGATTGGGATTATTGATGTATTTCAGGCCCCTACAA
GGTCAACGGTGTTCCCCTTCGTCGCGTGAACCAGTCGTACGTGATCGCCACGTCGACCAAGGTCAACATTGAGGGTCTGGAGCTCCCTGCCATCGACGAC
GCCTACTTCGCCAAGGAGAAGGCTGCCAAGAAGACCAAGGAGGAGCAGTTCTTCGCCCAGTCGAGCGCCGTAAGTGCTTGTTTTCACTCTGTTGCTATCC
CCTGCCGTTCCTTTGGTCGGTTTTTCGAGACCACTACAAACAGTTCGTCCACATCCAGCAAGGAAGTTGTTCTGCAGTTGGAGAAAGAGATTGACGAACC
CTTTGGGATCTCTCTCTATCTCTGGTTTCAGTGCTCTTTCTTGTGTGGCGAATTGGGTAGGAGGCGTGGATGTCTTAGACGTCCATAGCTTCTTATCACA
TCATATGAGCGCTTGGGATCGCTTGCTTCGGCACATAAGCTCCCTATAAGACACTGACCATGTTGGTGTTATTTCTCTCAGGCCCCCGTCATCTCGGAGC
AGCGCAAGAAGGACCAGAAGGCCATCGACTCGGCTTTGATCAAGAAGCTCGACGCCGAGCCGTTCCTGAAGGCTTACCTGAACGCCAAGTTCTCGCTGAC
TAAGAACGACCGCGCCCACGCCCTCAAGTTCTAAGTGCGCTCTTGCTATCCTGTGTAGCAGTGTGATGTGCGATGATTGAGATAAGAACAGCAACCAATA
TACCTGATGAACTTATCACCAAACATAAGTGTTTGTGTTGCATTTACCCTAGAATCTCATCGAGTAGATCTTGGAGTATTGTACTCGTCATTGAAGGTTG
GACCATAACTTATTAACATGCCACACAAATGGCAATAGCTCTTCGAGTTTTTATCCGATCAGATTAAGACGGCCACAACACTGTTCCTTAGTGCGTTGTA
CGTGCATTACAACTTTTACTTCGCTAGCAACATGTCTGGGTCAAACACCAAGGCGCGAGAGCTGCCCCCATGTCCGAAGGGCTTTGCCGTACGGTGTTAC
GAGTTCATGACCATATCGAAGGAAGGAGGGCTCTTTAGGGGGAGGCGGACCCGAGACCTTGTAGCTGCGTGTATGAAGATTGCTCGTGGCACCGCTACGA
CCGTAATAGACGAATACAGAGCCGACAACATTACCAAGTTCGAGGTCGGTGCACCATATTCGCGACGCCAGCACCTTATCAGGTGTATATCGTTAACCTG
TGACATATGATACTTTCATCTCAAACCAAGCAAGCGTGGCATGAAGTGAGGACAAACTACCTCTGTAAATCGATGTTGGCTTAAATGATTTGAGCCCCTG
GTTAAAATATCTATGGACGTTTTTTTACTACATTTGCACTTTCGCCTGTAAATCCATGTGTATTGCCCCCCCTCCAATCAGAAGTGCTCCTCAAGAGCAA
CCCGTTTCCCGCAACTCTGAAGCCTCAGGAGTGCGTTTGTAAAGCGACCCGTAGCGCAGTAACGGCTGCGATTCAGCCGATTTTGACCTCATTTTTGAAA
TCTAGACCCAACTTTGCACCCTATATCTAAATGTCGCTATAGGTTTTAGGGCTGTGAATCTTCATAACCGATGGCTACATTTTGGTCCAACGACTTGTGA
CGAGTACAATAGGGTGTTCTCGCTTTTGCCTTCTTGTAATTCGTCGTCGTCGCTGTTTTCTTCCGACGAGCATTTCCTTGTCGAATAAAGACCGGTGCTC
TCACTGTTGCCTTCATTTACAAGCGTGTTGTAGCTAGAGCTCTTTTTCACCCTGAGCGAACCACCGCTGGTCTGAATGGAACCAGTGCATTTTGCATCTG
CTATCTCGCCACGAGCACTGACAAGCGAAGAGCCCCATTCTTGGTGCCGTGCGTGTGCTTGGTATCGCTCTTTGGCTGTCCACTCTCGTCGCGATGACAT
GGCACCGCCACCAGCCCAATGACTAGCAGGCTCCACAGCAGATACCGGAATTTCCTCCGACTTTTTCGAGCACACACTTGTCCTTCCAGCATAGCTAGAG
TAGCCTCCTATAGTTTTGTGGTCGCTCCGTAGCGGCAACACGGGCACTTCTTCCTCGTGCAGCACTAAAGTAGGCACCGCAAGCGTTGGCCGTGCCAATG
GCTGGTCGAAAAAGCGGTGTTGAAGGGCTTGCGCCGCTGTGAGACGTCGACTCGGGTCAAATTGCAGTAGGTCTTGGACAAGTTGAACCGCTGTGGATGG
TGTGCCGGGCGGTAGAAATCGAGTCCAGGACACAGGAGAGCACTTGGGGAAACGCATCTGCATATGAGAAGACATCGCTGCACCTTCAGGCCACGTCTCC
TTGGTCGGTGTTCCTAAAACCTTGCAGATGCGGTAGAACTGGTCAGCCTCTGACGTCCCTGGGAAGAGCGGCGTACAAACCAGCAGCTCGACCATGATGC
ATCCGCAGGCCCACATATCAACGGGGCTGTTGTACGTTGTTGAGCGCAGTAAGAGCTCTGGCGCGCGGTACCATCGCGTAGCCACGTAGTCTGTAAACGG
CGGTCGCGATCGAATTTCGCGTGCTTGGCCCAAGTCAGCGATCTTGAGTGTATCATTGTGACACAACAGGTTCTCAGGCTTGATGTCGCGATGGAAGAAT
CCGTGCTTGTGCATGTATGCTAGGCCACTGAAGAGCTGGTACATCATCGAACGGATCTGTGCCTCTGAGAACCATGGATGCGGGGGCACCGAAGATCGAG
ATGAACTGGTAGCATCAGAATTTAAGCTTGGATCGCCTCCAGCACCACTTGAGCTGGAGCTTCCGAGAGTTTTGAAGTTGCGCATGACCCGAAAAAGTGA
CGTCTGCATGTACTCGAACACGAAGTAGAGCTCCTCCTTGTCTCGAATGACCTCTTTTAGAAGCACGATGTTTTCATGGCGAAGCACGCGCAGCGACTTC
AATTCGCGTAGCTGGAGACACTCCTCCCACGTGGGGAACAACGCCTTGATCTTCTTTACAGCGACTATTTCATGGGTCTTGACGCTACGCGCACGCGACA
CTTCCCCGAAAGCGCCGTCACCAACTCGGTCCAGCATTTCATAGCGGTTCATCTTGGACCTGCTCCTCAACCCCAGCAATGTGAATAGTAAGGCACCCTC
TGCACCTATAAACAAACACAAACCAGTAACGATAATTGCTAGAAAGGTCAAAATCCTTTCGTGTTGCTGACGCGGCTTACACTGGTTCTATGATGATTTG
GTGAGCTTGCTGTAGCTTTCGATCATCCAGCGGAGTGTGCGTGCTACCGTATCAATGTCGACTTTGTGGAGCGCACTGTGTAAACAAGACAAATCATGGT
TAGATTTCCGTTGAAGAAGTAGAGAAGTATGAAGGCGGGCGCAGTTATACCTGACAGGGAGTACAGCTAGATCGGTGGTCTGGCGCAGCTTGTTGAAGTT
TTCTTCCGCGCCTGCATGATGCCAGAACAACGTCAGAGTGAGGGTGCTAAGCACTCACAGTAAATGTTCCTCCCGTACCTTGCTCATCCATCTTGTTGGC
AACTATCAGGGACGGACGCGACGAGATTCCTGGAGCATACAGCTCCAGCTCTCTTTGAAGATGAGTGAAGTCCTCGAGGGGATCACGTCCCTCCGAGCCC
GCCGTGTCAAGCACATACATTAAAATCTGTAAAAACACCGCACACACACCATGGTTAGCTCATCGCCCAGGTAGAGGAGACAGATCAATGATACACACAC
ACCTTTGTGCGCTCGATGTGGCGCAAGAAATCGTGACCAAGACCAACATTGCGGTGTGCACCGTCAATAAGTCCAGGGATGTCAGCCACACTCAAGCGGA
ACGTGTCTGGGAACTCCACAATTCCCACGTATGGGTGAAGCGTCGTAAAAGGATAAGGTGCAATCTCAGGCGTCGCACGGCTGAGAACGCTCAACAGCGT
CGACTTGCCCGCATTCGGGTAGCCTACAAGACCCACATCAGCGATGGTCTTGAGTTCCAGCTCGTAGTATTGCGAGGTACCCGGGTGACCCGTCGTCTTG
TTCTCCGGCATGTGCTTGCGCAGCCGTCCGAATTTGGTCGTCTTGCCTGCCAGGATGCGGTTACCCAGTCCAGGCTTTCCGCCCTTCGCAGCAAGGAACG
TCGCTCCAGGCTCGTCTAGATCACACACCACTTCCATCTGGTCCACAATCTCGTACTCGCCATTCTCCAGTTCGCGCTCGTAGCGCTCCACGCGCTTGAC
GAGTGTACCACACGGCACCTTGACGTGGCAATGCTTGCCTCTCCTTCCAGCAGAATCATTTGCTGGACGCCAGCCACGCAAGAGTCAGTACCCTGAAAAA
GTATTTGCAGCACACAAATGAATCCCATGCACGTACCCATGCCGTTGGTGCCGGCGCCTCCCCTAAAGTGGTGCGTGGCGTTCGCCAAGTTCTGCATCTT
GTCGGAGGCTTCGATCACGACGTCTCCTCCAGCACCGCCGTGTCCGCC