Description :
From Genome Similarity Track
Location :
Scaffold_321:4417- 7171
Transcript NameFunction/comments
Phyra_85817AlNc14C579G12207

Sequence
2754 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCTGATATTCTTGCTCACACTTATCACAC
GTGACCTGTCACTGAGAGTATGTCTTGTGTGTCCACAGGAGCTGGATCTTGGATTCGCTCAGTTGCGAGGAGAAATCTGTAAGCGATGATGCGCTCGTCA
AGATCACCAGATCGAAGCAGCTTCCGCATCTCGCGAAGCACGCTCCCGGCTCCCTTGGCGTTGATGCCATTACCCCGCAAGTACTCGAGCACGTTGCGCT
CAGCGAGACGACCAATTTCCAGCACGTAATCCTTGAAGTCCACCGTCTTGGCGTCAAGGATGAAGCCCTGATCGAGGAAGAGCTTCATAAAGGCGACAAC
GTGGCGGGATTCCGACTTCTTCTGGCGATCGGCGGAGTCCCAGGCGCGCGGCAAGCGCGTGTACCACTCGAACCACATTGACGACAGGTTCGTAGCTTGT
TTCTTTCTGCGTTTAGGCTTGGGTTCTTGATTTGACGCTTCATGTGATTGTTCTACTTCAGTCGTTTCTGGTAGCCCCTTAGACTGAAGCAGCACAGCCT
CGACAATTGTCATGCGCGCAGCCATGGCCTTGTTCGAGGCAATAAGCTCATCAATTACATCTAAAAGGTGATCGATTCTTGGGCTTGTGTACTTGCTTGT
ATTTTGCTCTGATTCTTGGACAGGTTGAGAGGCATCGTCATTCAGGGCGATAGACCACGCGAGCATGTCGGCGGTCTGGATGCCAACAGCCACCATGCAC
TCATCCACACGCATCACGATGGGGGCAGGTGGAGAAAGCTTCTTCAACCTCGGGTAGTACCGGATCAGGTATGCAGTGAGAACACTGAGAACCTTGTTGC
TTACGTTGAGCCGTTGATCCTTTAGACCCGAGCAGGAACTGAATAGGAGCGTTTGGAAACGTCCAAGTTGTTCCTGAGTCGTGTGGTCCAGCTTCACGAT
GTCGATGATCTCTGGATTGTCGTCAGCGCTCCAGCCGCTCAAGACTCGAGCAACCTTTCTGTCCTCCCGCGCTGTGTTCGTGATGTACGCGAAGGCTTTG
TTGGTCTTCGTCATATCCCATGCGCCGCGGTCAAAGATCCACTGGGCAGCAAGACGGTCATCTCCGTTTGCGTGCTGGGCTCCACCGCGCCGGAATGAGT
GGGAGGTAAAGTCGGCAGCTGCTCCAGCCGGCTCAGCAACACGCTTCAGCATCCTGTTCACGTACGCATGCACACTGTCTTCTCCCCGCTTGGGTGTCTT
CTTCTGCGTTGAAACGGTTGTGGTCTGTGTCTCTGTGCTCGTAGGCGGAGTGAAGACGGCGGTAGCTGGGGAACAGCTTGCGTCTAACGATACCGGCAGC
GATGCCGCCGCGGGCAACACAGACACTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN