Description :
From Genome Similarity Track
Location :
Scaffold_257:4417- 6209
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_257-snap-gene-0.17Major Facilitator Superfamily (MFS)

Sequence
1792 bases(100 bases per row)
GAACGATGAAGCATACCTCAACGTTCGGGATGTACCTGCTCGCGTGCTCATAGAGAGACGCGACGACCAGCGGGAAAAACGTCAAGCCGATGTTCTATGC
ATGCACAACCAACAAAATGTTTAACCGCATAATGAGAGGCACATACGAGGCAAAGAATAACAGGCAGATAGACATCAAATGCACGCACCATTGCTGCCGT
CAGCACACCGTATCCAGTGCCGATATGGTGCTCTTCTACCACCAACGGCACTGATGGCCAGAGCACGGACGCGAAGACAGTGTATGCCAACCCTTGCAAC
GTGAGAGGAATAACTGGAGTCACGCTTGTGAAGCCGAGCAAAGTGTGCGCCAATATCAGCACGATTGCAGCAGCAAGGTTGAGCAGCGCGCGGAGGCCGA
TGCGATCGACGGCGAAGCCAAGGAACGGAGACACTGTCGCAGAAATCGAATACGGGATACTCATCGGTGTAGCGGCATGTTCAGCGGCTTGGGTTTTCTT
CTCGCAGTACACTTTCGTCAGTGGTCCGTTCCTCCACGCATCACTATCGCAGTTGACCTTGCTCTCCCCAATGTACGGGCTCGATGTGGAGCACTTGAAT
TGATCTTGTGGCTCTGTAATGGTACAGTTGGAAGACAGTTTCGGCAATGGCCATGCGTACGGAGTCACACTTGGACATCCATCAGCAATTGCAGTGCAAT
CGCTCTGATTTGCATACGCACCTTCGCCGCAGCGAATGCATAAACTTGGTGGCTGTTTGAAGTAATCTCGCTCCATCAGCAAGCTGCTCGCGATGCTATT
GAATGGGATAATGCATCCGTAAAGCACGATAGAGCTAATCACCAGCATCCAAAAACTCGCGCGGAAATCTTTCACATCGCTGAGCTTTATGCTCTCTGGA
ACGAAGTTGTCATCTTGGGTGTCTTCTCCAAACTCTGTTTTCGACTGGAGTGATTTCGCGTGCTTCACGCGTATTTCGATCCATACGATAATTAAGGCAG
ATGCACTCGATATGAGGCACATGAGCACGCCAACCCAGAGCGCGGCCGACACATTCGCAACTTGTGCAACCATTGGACTGAGCTCATTGTTGATAACGCT
TCCAAGACGAGAAATGCTCAGGTTTAAGCCCATTGCAAACGCTACGTAAAAATATCGAGAGTCACTTGATGCCATACGCCAGCACAACAATTCGACAGCA
GCATGAACTCACCTAGTTCTTCATTCTTGAACCATTCAACCACAAGCGCTCCTTGTGCAACGGAGAGACACTCACCGCCAAGTCCAACAACGAAACGACC
TGCCTATTGAGCAAGTGCACAAACGTGACATTAGTTGCATGTCTAGGGATCAATGCATCACACTCCATCCTGGGTATGCAGTAGGCAAGCCTTACAAGCA
TGAGATTGAAACTTGAGAACGATGAGCCAGATGCGAAGATGATTTGCCCAAACAAGATGAATGAGGAAAAGAGCAACAGTGCCGTGTTGATTCCGAAGCG
ATCCACGAACGCTCCACCAAAGAACGGTAGGATGGTGTTTGGAATCGAGTAGAGCGAGTAGAGGAGATTCTGCACAAATGTCAAAAAGTAGATCATCATT
AGGTCATCATCCAACTGCATGGAGAATCGGCAATTACAACAGCAACTTACAAAGCGCATCTCGAACTCGTCCCGCGAATAGTTCCCAAAGTGTTGCTGCA
GTTGACTCTTGAGCGCTGCTGCATTGTCGTAGCAGTAGTAGTTGCCGACCATGAGGACGCACGAGAGCGCAAGCACAACCCAGCGCAGCAGC