Description :
From Genome Similarity Track
Location :
Scaffold_211:44153- 46276
Sequence
2123 bases(100 bases per row)
TCGATGGCGTAACAGGTCACGTGGATGGTGAAGTGGGCCTTGCGGCCCTCTCATCATTAACTGCTCTGTTAGAGCTAGAAGAGTTATCTGTAGACGAGTT
CAGTCAGACCTTAAGGGCAGGCGACTTATCCGATATGGTGTTCCTTAGACCCGATAATGAGTTCAACTCCTCGTCTCTATTCGATGGGACGGTCCTTGAA
AGTATACAGGCGGCACTTAGTGCACGAAGTGGGTCATCTATTTTGGAGAACCCTCCAGACCCCTACTACCTTTTAATTAGGGAATTTCAAGATGTGGTAT
GTCATAATCTACCGTCTGTATTACCTCCCAATAGGGGCGTACGTCATGAAATTAACTTGGTTCCTGGAACCAAATACTGCGGTAAAAGGCTGTGGCCTTT
TCCAAAGGAGCAATATGACGTCATTGAAGAGTTTCCAGTACTAAGCACGCGGCGGAAATGGTGCGGGAGAGTAAGTCTCCTCATTCCACACCGACATTTT
GTGTAAAAAAAACTAATAGTAAGTGGCGTATTGTGCACGCTTATAATAAGCTTAATGCGAACACTATATCAGCACAAACACCCATTCCTAGAAAGGACGT
TCTTCAGAACAACATGACAGGATGTACAATGTACGGTGCACTCGACCTGGTCGATGATTATTATCAACTGCTCATGCGAGCAAGTGATATCCCGCTTACC
GCGGCTAGTACTCCAAGTGGTATGCTTTGGGAGTGGCTGGTGATGCCCCATGGACTTTTCAATGCCCCGGCTACGTTTAATCGTCTGGTGACGCAATTGT
TCCAGCCTCACCGTGCGTATACACAGCCATATTTCAATGACATGTTTGTCCATAGTCGGGCGGAACAGGGTCGGTCGGATGTGGATAACCACATCGACCA
TTTACGAGCTGTGCTCAAGTGCATGCGCACTAATAAGCTCTATGATAATGCATTGAAAAGTATCTTTGGTGCGGATGAGATCCCATTTTTGGGAGGCTTC
ATTGGGAAGCGAGGCATTCGGGCATAACCTGCAAAGGTGAAGGCCATAGTGGATTGAACAGTTCCTAAGAATCAAAAAAACCTACGCAAATGGCTTGGCC
TTGCCAATTACTTGCACAAGTATAGCGAGAATTACACTAATATGGCTCGGCGATTATCCAATTTCCTTAAAAAGGATGTGGAGTGGTGCTGGACTAGCAC
CGAAGCAGAGGCTTTTAAGGCTGTAAAGGAGAGTCTCCTACATGCCCCGATTTATGCTTTGCCAGATTCTGATCGGCCTTTCAGTGTCGTCTGTGACGCT
TCGGATTTTGCTATTGGCTGTGCTCTGTTACAAAAAGATGTTGAGTGACGCGAGCTTGTCATCGCTTTTGAATCCCTTCAGCTTAAAGCTGCTGAAATAC
TGTACCGTTCACGACAAGGAGCTACTTGCTATAAAGTATGCTCTAGTCAAATACAGAGTTCACCTGCTTGGCTCTAAGCCTTTTGTAGTCTATACCGATC
ATGCTTCTTTACGCACGGCGATCCAATCGCCTCACCTCTCGCAGAGGATAGCCCGTTGGCTTTCATTATTTGCGGAATATAAGGTGAAGTATAAGCCGGT
AAAGCAAAATACGCTGGCTGATGCGCTGTCACGCCGTCCTGATTATGAGATTGCTCATGTTACGATTTTGTCGTCGTCAATTACTGACTTAATCCGTGCA
TCAAATGCCAAGGATGAACAATGTGTAGCTTTGCTACGTGCTCTTGGAAGCGATGAGTTTAAAGACTCGGACATTAAATTGTCCGCACGTTTGCGTACGA
GTCTACATCGATATTCTATCGATAACGGCTTGTTGTGCTATCGCACGGATGCCGCGGATACCCCGCGTATCATTGTTCTTCATGACGAGGAACTGAAGTA
TCGTATCCTCTATGAGGTTCACTCACGACACAGCTATTATCGGTCATCTCGGTCGTGAGAAGACCTACGGCTTGGTTAGCCAGATTTATTCGTGGCCCAA
AATCTATAAATGGGTAAGCACTTATGTGCACACATGTGAGACGTGCCAATGGGTCAAATCATCGGCGCATGGACTGCGCCGCTGGCTAGTTTGTCTGTAC
CCTCTGGGTGTTGGGAGTCCATG