Description :
From Genome Similarity Track
Location :
Scaffold_709:4415- 6648
Sequence
2233 bases(100 bases per row)
TGCATACGGATTTCGTCACTACAGAATCATCATCGTCAGCGCTTTGACGAGAATGTCGTCGTCTCGGCGATCGGCGTGCACCTTTCTTGCGTTTACGTTT
TCGCTTGCGTCTCTAGTCACTGCTTGAGACTGGCACGTCGCTGTCTCTGTAGGATGAAGTACCCTCCTCCAGACGTGGGAGCTCTGTCTCCACCACGTCG
CTCACATTCGGATGCACAATCCGTTCATTCTTGTCGATAAGAGGCGGGAGCTCGTCGTAGACCGCCCCAGACGTATGTGGTGGCCTCTGCTCGACCACCT
CAGTTACAATCAGGAGCCTCTTCTCGACCGCCTCGATATTGATCAGGAACCCCTGTTCGACCGATGTCTGTATTTTCTGGAACCGCTGTTCAACCGCCTT
CCTTTGTGGATCTATCAGTGTGACATAACATACCGGACACAAAGGGCCATCGCTCTCTCTGTGCTGAATTCTAGTCGTGGCGAGTTCGTTCACGACCCTG
ACGTGAGGCCAATCGGATGACTCAACCAACAAATGAGTGAACATTTTACTTCCGTCATATCCGCTTTGTCATTTGACGGACCGAGATAGCCAATATATCT
TCGGCTGACACCGTGACAGCCACGATAACCCCAAGATGCAATCAAATGCATAGTTCATCTCGTACACCAGAAATTCATCATTGCTTCAAAAGCCGTCAAA
CGTGTATGGAAAAATCACTGTTTTATGCGGGAAACGCTGTAGTTGTCCATCAGCAATTTTGACAACGATGTCACCTGGACCTTCTCGACCCGTAATCGTA
GACGGGGGGAGGTACAAACATGATGCTCGAAAGAAGTTGTGGATGCACCCGTATTCATTAACGCTCCTAGTGGTCGCTTCACTCCAGCAATGATGAGACT
GATAATAATCAGTCTCGAATCGTCGCGCATGGTGGTGGCATTGAAGTGAGTATGCATCACTTTGGAGCTAGGAAGCCGAGCTTCCACCTGAGTACTCGGG
GTTCTATTGCTGCCAGTAGGGCGCCCCGCTCCTACCGGAACCGCTCGTTTTTGGTGGGACCACTAACGACACAGTATGTCCCCGTGGGACAGCTGTGTTC
ACGGACATCGGCGCTGGTTCTCGGCAGACGGCCGCACGATAGCCTGTCTTGACTCACCTATAACACTTCATCGTGTTTTGGCTTTGGACGTCGCGGCCAA
ATTGTTTGTCGCGACCACGTGATGCATCGATTGCATCTATGTCCATAGGCTCTGGGCCAGACGTACGCGGGCATTGCGACGCTGCCTGCAATTATGACGA
CGCGACCTTGTAACCTTCACGAAGATAGGGGGCGAATTCATCGTCGAGAGTCTTTGGTTCAGCACGTGTGAGACAATAACGCGTCATGCCTCTTGCATAC
AGAAGACAAAGACATGGACTTGTGAAGCCATATCGATCGGCTGCGTGATAACACACGAAGCAAGATGTCGCGTCTTCTGCACGTAATCACGCATCGACAG
CTTACCTGTAGACGTGAAAAGAAGTATGTACGTAAGCGTGAATCATCTTGAGGAGGCTCGAACTCCAGTCGTAAGTCGCGCTGGATATCTTCCAGCGTGG
GGAACGCCAACAAGTTTACAACGAGCTTTCCAAGAGCCCATTATTTGGCTTTACCAACAAGCCAAGACAGCAGGAAATTAACCTTGGCCGTCGGATCGTC
AATCAACCTTGACGCTATCGCGATCTCAATCTCCCTAAACCAGTGATTATGGGGGAGACGATCCGGACCATCACCGGAGTACGTCGACGTCTCCATTTTA
ATTGCATCATAATGGTAGGTGTGGGAGGGAGTCTGTAATCGCCGATTCGCTTCGGAGAGCTCTCGTATCATGTAGTCTTGAATGGCGGCACGGTGTTGCT
CGGGCGTCGCTGTGTTCAGCAGCGACGTCACGAAGATTTCATCAGACACCGCCGCAAGACGGTGTAATGCCTGCCATTCCACAGTAGTGAGATGGGGAAA
GTTTGCTTGCTCCAGCTAAACCGCTGAAGCCATCGAAGATTCGTTTATGTTCATCTCGAACTTGGTCAAGGGAAGGACTACGAAGTGGATACCAGGTGTA
ACGGGGTTAGAACCCCGCTACCGTCTTACACTATAAAGGGCGTGAGGAAGCGCACTTATTTATAAGGTAAATATAACTCTGTTTTTATTTTATGTTTTAT
ATTTCGCAATAAGTGCGAATATGTTCTCTAGCT