Description :
From Genome Similarity Track
Location :
Scaffold_552:4415- 5819
Sequence
1404 bases(100 bases per row)
TCTGCACCCGGgACGATGCcGTTGCGGCTTtCAATCTCTTCTGTGGCGTCTGTGGTATTGGTACGCTCGGTATGCCAGCCAACTTTGCTCGAGCCGGCCC
TGTGTTCGGACTCATTGCCATGATTTTCATGGGCTTTGCCAACATCTACGCGTCGGTCGTCGTCTCCAAGaCcATGCtGGtCgcgCCcAAGTCGGTCAAG
ACGTTTGGCGACATTGGCGAGTGGTGCATGGGTCGTGGTGGTCGCTGGgCtGTTGTGATCTCGCAGATGTTCGTGTGTCTGCTCAcaCCCATGGCTTtCC
TCGTGCTTGGCGGCGTCATGCTCGaCAAGCTCTTCCCTGGTGCCTTCAGCCAAACTTTCTGGATCATCTTCATGGCGCTCATGTGCCTTCCAGTGTGCTT
GACGCCGACGCTCAAGGAAGGCGCTGGGGCTGCGTTTGCTGGCTGCATGGGCACAaTTGTCGCTGATGTCGTCGGTGTTGGCATGCTGATCCACGGCATG
AGCGGCCATCCGAGCGTCCCCAAGCCAGACGTCaCTCTGGAACAAGTCGTtGAAACGTTTGGCAACTTGGCCTTGGCGTATAGTGCCGCTGTGGTCATCC
CGTCGCTGCAGCGAGAACACAAGCAGCCGGAACGTATGCCCATGGTCATCTGTGTGACCATGATCGTTATCACGGCACTCTTCATCGCCCTGGCGTGGTC
GGGGTACTCGGCGGTCGGTTGCCAGATCTCGGGCAACCTGCTCTTCAGTGTCTTCCCAGAcGCCACaGgCATGTCGGCACTCGGCATGAAGGCCGACTTC
GGTGCCGCTGTCATGGCCTATCTGTTCATGCAGCTGCACATCACGATCGCATTCGCGGTGCTCGCGTACCCGGCGTTCTATCTGTGTGAACGGATGCTTT
TGGGCATGCACAAGACGGCTGCTATCACGACGGATGACGATAGCGAGGAGATGCTGCCGTACCATAGCAGCAGCACGCCTGTCAGCGCGAGTGAGTCACC
CAAGCGACTCGGCGACGACGAGGAAGaCAGCCACGAGGCAGACGAGTACAAGGGCGCAGCCAATATGGTCAAGTACATCGTCCTGCGtATCAGCATCGTC
GTCATCCTcGTGATCGTCGctATCGTGCTGCAGGACAAGTTCATCGAACTCGCCGACTTTGCcGGTGCCTCTGCCAGTACTGTGTCGTGCATCTTGTTGC
CCATCATGTTCTACATGAAGAAGCTCGGGACCAAGATGCCGACCTACGAGAAGGCAGCCGCCGTGCTCGTGCTCGTGGTCTGCACCGTGCTAGGTGCCTA
CGTGACGTACAAAACGGGTAAAAaGCTCTTCACAGATGCGGCCGCCGGGCCGAACGACCCGGTCTTCCCGTTCTGTAAACCAGACGACCAGTTCACTTTG
TACT