Description :
From Genome Similarity Track
Location :
Scaffold_30:441499- 444408
Transcript NameFunction/comments
Phyra_78313DEAD/DEAH box RNA helicase, putative
Phyra_71604DEAD/DEAH box RNA helicase putative

Sequence
2909 bases(100 bases per row)
GCTGGCGCACAGATTCAAGGTAGTGGCAGCTGAATATTTGGAATTGGCCTTTGAGGTGTGGACTCACGGAGGAATGCTGCTGCTTCTCAGAATATCCCGT
ACGATACGCTGATGCAGGATCTGGGTGTGTCGACGGTGCGCGAAGTGGAAGATATCCTCATCGACACCATCTACTCGGTACGGACGAGGACGTAGATTGG
TGTTTGGTTGCTGTATTTACAGGTGCCGGTTGTAGGGTTTGATTCAAGGCAAGCTGGACCAGAAGTCGCGCTGCTTCGTCGTCAAGTACGCAGTTGGACG
TGATACGCACCATGAGGACATTGATGACATGATTCAGAAACTCACCAACTGGAAGGCACAATCTGCGGACATTTGCGAGAAGATCAACTCGATTCTCAAG
TAGGAGTCGCTGCGGAGCGCGGTGTCTAGCTTGGAGTATTTTCTAACATTGTTACTGTTGATGCCAGTCTGGCGGAGAAGCAGGAGGAAGACGAGCGAAC
CCGGGAGGAGGGTATTCGCACCAAGATGGCTTCTCGTACAAGTGAGCGAGGCAAGGGCTTTGCTAGTGCTGGTGGAAACGTCCGCCCAGGCGAAGACTTC
AATCTGTACTCGGATGCCGGGCCACGACGAGGGTGAGCACTGTAAATACCCTTCTTTTTCTTGCCTCGTGTTTCTTACGACGTGTCTGCTGAGCAGAGCA
CCTTCCAAGCAGCGCATGCACTCGATGGGCCGCAAAGGCCGGATGTAGGAGCGACACGCAGCCCGAAAGCGCTTATAAAAGCAATTTTTTTGCATCAAAA
ATCGCATCAGCCCAATTTTCACACTGCCTTTCTCTTGGTTTCAGTATTGCCACTTTACCTCCAACCAAAAGCATGGCGATTCCTAGTCGTGGCAATGGTG
CGCAGCGCAAGCGTCCGATGTCGTCGGGCCCGAGCTTCACGCACCACAAGAAGCGTCCGCACGCGAGTCCAGCCATCACGGAGCTGCAGCGCACGCGCCA
GCGCCTGCCCATCTACGCGCACCGCAGCCGAATCATCGAGGCCGTGAATGGCCACCAAGTCGTGATCCTCGTGGGCGAGACGGGCAGCGGCAAGACGACG
CAGATTCCGCAGTACATATGGGAGAGTGACCGCGCCCACGCCCGTGTGGCCATCACGCAGCCGCGTCGCGTAGCGGCCATCACCGTGGCCCAGCGCGTGT
GCGAGGAGGCGAACCGCGGCCCGCTGGGCGACGCCGTGGGCTACTGCGTGCGCTTCGACGACACGACGTCCAAGAACACGCGGCTCAAGTTCATGACGGA
CGGTATGCTAGTGCGCGAGGCACTGCTGTCCCCGACGCTCGAGAGGTACTCGGTGGTGGTGCTGGACGAGGCGCACGAACGCACGCTTCAGACGGACATT
CTGTTCGGCATTGTCAAGCGCGCCATGCGCAAACGCAAAGACCTCAAGGTCGTGGTCATGTCGGCGACGCTGGACGTGGCGCTGTTCCGCAGATTCTTTG
CGGACTTTGAGCCGTCGGTGATTCAGATCCCGGGGCGGATGTTCCAGGTCGACGTATTCTACACGGCCAAGACGCAGCCGGATTACTTGGACTCAGCCTT
GGTGGCGGTGCTGCAGATTCACTTGGACGAGAAGACGAGCAATGGCAGTATTCTCGTGTTTCTCACGGGCCAGGAAGATATTGAGACGCTGGAAACGCTG
CTGGAAGAATACGCGCGGTCACTACCTGCTGATGCGCTGAAGCTCATGGTGTGCCCGATTTTCGCTGCCATGCCGCGCGAGCAGCAGATGAAGGTGTTTG
AACTGGCACCGTCAGGGGTGCGCAAGGTGATCCTCGCCACGAATATTGCAGAGACGTCCATTACCATCAACGGTGTTCGCTTCGTCGTGGACACGGGGCT
CGTGAAGCAGCGCTCGTTCGTGGCCTCGAGCGGTATGGAGATGCTGCAGACAGAGTCCGTCTCGAAGGCGCAGGCTTGGCAGCGTACGGGTCGTGCTGGA
CGAGAAGCTCCGGGTATTTGCTACCGACTGTTTCCAGAGGAGACTTTCGAGCAACTTCCGGAGCGGGCGATTCCGGACATTCAGCGTGTGAGCTTGGAGG
TGGTGGTGCTGCAGCTGAAGTGCATGGGCATCGACGACGTGCTGGGCTTTGACTTTATTGAGAAGCCCCTCAAGACGTCCTTGGTCAAAGCTCTTGAAAA
GCTGTATGCCCTGGGAGCGTTGGATAACAAGGGCAAGCTGACTACACGCGGCCGACAGATGGCTGGACTGCCCGTGGAGCCAATGTACGCTGTGATGCTG
CTGAAGGCGACGGAGTTGGGCTGTGCCGAAGAAGCGCTGAGCGTGGTGGCTATGCTGTCCGTCGAGTCCATCTTCTACTCTCCTCGCGACAAGAAGGCGG
AGGCGGCGCAGTCGCGCGCGCGGTTTGTTGCGTACGAAGGCGACCAGATCACGCTGCTGAACGTCTTCAACGGGTACACCCAATGCGGAGCGAAGCAGCG
CAACAAGTGGTGTCGTGACCACTACATCAACTACCGTGCTATGACGCGTGTGGAGAGCGTGCGGCTGCAGCTGAAGGGGTACCTGGAGAAGCTGGAGCTG
CCCATCGATTCGAGCTTCCCCGACATCGACCCGCTGCGCAAGAGTATCGTGGCCGGCTTTTTCCTGAACACGGCCATGCGGTCAGTCGCTGAGGGCCTGG
GTGGCTCTAAGACCGCGTACAAGACCATGTGCGGCCGGTCGGAGATCGTCAAGGTGCACCCGTCGTCGTCGCTATTCATGCGCAACCCGCCGCCCAAGTG
GGTGGTCTACAACGAGCTGGTGTTCACGAGCAAGCACTACATCCGGTCGGTGGTCGTGATCGAGAAAGAATGGCTCGTGGAGCTAGCCCCCACGTTCTTT
GCCAAGAAA