Description :
From Genome Similarity Track
Location :
Scaffold_96:44141- 45147
Sequence
1006 bases(100 bases per row)
CAATTGACAAGCTGCTATGGCCACGCCACGCGACAAGAAGAAGCGGAAGACACCAGAAGATGACGCCGTCACGCCTTCTTCCTCTCCAGCAGCAGCAAAA
GTCGCGAAAAGCGCCCGCAGCGGAGGCTCGAACCCCATCACCGCCACCACCAGTAGTCCACCAACTGGGGATGCTACCGCTGCGTTCGCTTTTGAGAGCG
TTGAAGCCCGTGCGAGAGCCGTCACAGCTGCGCTGTCCCGTGAGATCGACACGGAGAAAGCGTTCAAGGGCGCAAAAGTGCACTACCTCACTTCGGACAG
AGCGAGTTGGGTGTACCACGTGCCGCGCTGGTACCGCCATGTCTTCAGTGCACTCTCTCGATCTTCAGAGGTGTCACTCTCATCTCCGGTACCCAGCGAT
GACGATAACAGCAGTAGCATCAACATAGTCAACGAACAAGCCCCACTGCAACCGGTTTCCTACTTCCAATGGCTGGATCAGGTGTGGGATCTTCATCCAC
AGCACCACGACATCATCAAGATGTTTGGCAGAGATGTGCCTACGCCCCGCTACCAGCAGGCGTACGCAGTGAGCTACCGCTTCTCTGGGAACACCTTCGA
GGCGCAGTCAGTGCCTGAAACGCTACAGCACTGCGTGACAACCATGCAAGCGATGGTTATGAACTCCGAGACCCACGCGAGCTTCCTGCGCGGCGTGCTC
GTCAACTGGTACGCGAACGGCGAGCACTACATCGGTCCCCACTCGGACAGCGAGAGCAGCCTCTTCAAGCACTCGCCCGTGTTCTCGCTCTCGCTGGGGA
CAACGAGAAGGTTCATCTTCACGGCAAAATCCCAATCTGGTGATAAGAAGAGCGAGGCTGCTGAACCCGCGCAGCGTCTGGAACTCGAGCTTGGCGATGG
GGACCTCGTCGTCATGGGCGGCACCACGCAGCAGACGCACAAGCATGCGCTGCCAAAGATGAAGAAATGTTTCGGCAAGCGCGTTTCCGTCACGTTACGA
TGCTTC