Description :
From Genome Similarity Track
Location :
Scaffold_106:44128- 48209
Transcript NameFunction/comments
Physo_141955hypothetical protein
Physo_141956hypothetical protein

Sequence
4081 bases(100 bases per row)
CGGGAGGCAGCTCTGCGACCAGTTGTCGGCGACGTGGTGGGGCTCCCACCGGCGGCGCTGGTGGTAGGGCTCCTTGAACCTCCAAGCGCGGTGTTTCGGC
TCGGCCCCGGTGTCGTCGCAGACGGGAACAAGGCAACGGCTGAAGTACGACGGTCGTTGTTGCCCGTAGTGTGTGCGTAGTGTTGCTGCTGAAAACCGGA
GGAGTTTAGCAATGAGCCTTCACGGGCCGTTTCGTCGGCTTCCAGCTCATGCTTCAGCGAGCGGGTGTGCGTGATCATGGCGTAGCAGGTGACGCACACG
CGCTGCGGAGTAGTGAATCCCTTGGCCTCCATCGATATCTTTTTGTCTGCACTGTGTTGGCTGCAGATGGACTTACCGCAATTGCGGCAGTGGTGGCGGT
GCTTGAACATGCCGAAGCTCGCGCGGCAGATCGAGCACTCGCCGTCGTGCTTCCACTCCGGGGGAGGGTCGAAATGGCCACGACTGTGAGATCCTCCGTG
TGAAGCACGACGATGCGACCTCCGGAACAGTGGTGGTGAGCCTCGCTGAGACCCACCGGGGATGGTCGAGTGGCGCGTTTGCATTGGCTCCTGCACCGAC
TGGAACAGTCGACCTCGAGGGTTAACTTGGGCACTAGTAGCACCACCAGCGGTGCTCGTGCTGTCCCTTGAAGATCCATTGTCGTTCTCATCGTTCTCAT
CCTCGTCATCCGCTTCATCGTAGAACTGGGAGCCGGAGGTCTGACGAAGGTTTTCGTAGCTGGGCATGACCGGCAGCGACATCTGGCGACTGTGGCTCCG
AGTCGACGCTCCTTCTTCAGCGTTGCTCATGGCAGCATTGGCGCTCATCGCTGAGACCATGGTCCGCAGCTCGTGCTCGGTGAAGACGCCATCGCTTTGC
AGTTGAGCGAGCACTGACGCCGTTCGGACCAAACGCGTCTGTTGCTGCTGACGACTCATTTCTTCCTGATTCTGATTTTGAAATCCTCCGAGGCTGCGAC
GACTGGCGGTGCGCAGGTGTGCGTCAAACGACGACCGCGAGCTTGTCGGTGTGCGTGGGTCGTCTTGGCTGCAGGTGCTGGTTGAAGAAGGCGACACGAG
ATGGTCGTGCGGCGAGTCCAGGCCGTCCACGTCGCTGAGCGACTGCTCGCTCATCATGCTAAAACTGTCTTCCGCCTCCAGCACCGACATCCCCGTAGCG
TCAAGATCTCCGTCGTCGCCCATATGTAGGAGCCCTATGAAGCCCACGTTGCCCACGTAGGGCTCCGGCACAACCGGATCGCTCCACGCCTTGTCTTCTT
CGTCGTCTTCCGGCCTCCTGACCCCGGACGCTTCTCCTTCTTCCTGGCCACTGAGCTCTCGTTTCGGGTCAAAGTTTGCCGTTTCAGCCTCAACGGAGCT
ACGGTCGTCGTCGTTCTGCTGCTGGAGGATGCTGCTGCGCTCGTGCGCACGGTGCAGCACCTTCAAGCTGTCAGCGTCGAGTCCGCTCTCCTCGGCGAGC
TCCAGCGCCGTGACGCCGTCGGGCGTCGGCTCGGTCACGGCCTCCGGGTACGCGCGCACGATCTTGCGCAGACACGAGGCCTGCACGCCCGCGCGGATGG
CGATGTGCAGCGGCAGCAGCTCGCCGGCGTTCTTGGCTCGCACGCCGTCCGGATATGCCTGCAGCAGCTTGGCCACGAGCGACAGCGGCACGCGGCGCAC
GGTGCAGGCCCAGTGGATGGGCAGCATGCCGTGGTCGCCGCGCTGCTCGGCCACGGCGGGGTCTCGCTCCAAGAGGCGCTGCAGTCCCTTCCAGTCCGAG
GCCTGCGCCAGGCGGATCGCCTCCGAGTTGCCGGCGGCGCGGGGCTCCATCATGCGCGCAGAGAATGGCTGAGTGAGTGGGTGGCGTGCGGCGTCGAGCG
TGGCGGAGGATGGCGCGCAAGAGAGAGAGGAGGAGGTGGAGACTTGGAGACTTGGAGACTTGGGAACGCGCCCGGAACGCCGGACGTCGAGTGGGCAGCG
CTGGGAGGCGCGCGCTTCTCTCTAACTTCTTCTGTGAAATATGGGTTCGTTTTCCGGGCATGAAGGACGGAGGTTGGTACGCAAGGAGTGGGCGTGTGCT
TCAACCTTGCGGACTTTAGCGGTCTAAGTACGCTCGGTTTGGGACAACAAGATGTGGTCCACGCCTCAAAACATGTCGCCGAAGAGGCAGAAAAAAGGCA
GTTCAACGTCGACCTGGACCAAGCACCACAAGTCACAGCTGCGGGCATTGCTGGGCAGCTACTCACACCTGGACAGCGTTCAGAGGGCTCCAGTGCCCGC
TGCCCGCGTGCCACTAGCGGCGCCCCGCACTCGTGGCGGCGCGGCGGCTCCGACACCTGCTGGCCCGGAACGCGACGGCAGAATGGTCGGGGAACACCAT
CGCGAAACGACTTCGACTCGACAACCGCTGCTACATGGCACCACTGTGGGTCCGTGGTCACCACTGACCTACAGGTGCGCGTGCTCGTTGCTCTGGTCCC
GAGAAGGTCCGCCCGCAGCATGATCCAGAAGCACAAGAGTCATTTCATACGGAAAGCTTGCCCAGACGCCCGCCTGGCCGTCGTCGTCCTCAACGAGCAA
CGCAAAACAATGCCGTCCGCTTGAGAAGCTCGCGACAGCAGCGTACTATCATCGTGATAAACGTGGCTGTAGATCGAGAACTGAAGCGCCGTTCTCGCGT
CGCTGACGCTGGACGATGGGCCAAGACGCCGAAGAACGCGAGGATTTCTGCCGTGGACGTCTCCTCGTCGGCTGCCGATGGTTATCCGAAGCGCGATATC
AACGCGAGGACACCCGTTTGCTGCCATGGGTATCACTCCTGCTTGGCTGAGACCGGAGGTATGTATGGGCTCTCGTGCTCACGACTTACTGCCGCAGTAG
ATCCGTAGCAAAACCGCAGTATCTGCTTTTGCGACCTCTGGTTGCTCCCCGCACTTGACCGAGACTGCTTTTTTGCTACAGCCTCGAGCTCCGGTAGTCT
TCGCAGCCTCGCTCAGTATCCTCTCGTCGTCCGAGATGCGTCGTCAGCACTTCAACATGGATCAGTCAGTATATATTGTACTCATGTACTGAATTTAGAA
ACTGAGAAGTGTACAAACATTCATTCCGCTGCATCCCTCAGATTGAATTGCTCGGCGCTCGGAGGCGATGCTGCGCCGGGCGATTCAGCGCGCGCGGCTG
CACCTGCCGGCGCCCATCGGCCACGACAACGGCGGCGGGGGCGACAGCTTCAGCGACGACGAGGACTCGCCCGTGAGCCCCAGCGTCGCGCACACCACAC
TGCGCGACGATGAGTCCGTGCGCGACCACTTCCGCAAGCGGCCGGAGGACGTTTCCGGCCTGCATTTGATCGTGGCGGGGGAGGCGGCGAAGGCGCGCAA
AGGCCACGTGGCGGAGCTCAGCTCGGACAAGCAGCGCCGCGCTGCGGACGCCTGGGCGCGCTTGCAGGCGCTCTACGGCCTGTTCCGCCAGCTTGAAGCC
GCCGCGGACGACGCTGCAGAAGACAGCGACACAGAGAGCGTGGACGCTGAAGAGAAGGAACTTGAGGTTCAGGAGAAGGAGACGCGCCGGCGACGCGGAC
GCGATGATGGCCTGCGGTCGCTGCTGCAGGAGGCGCGGCTGCCGCCGGGCGTGATCCTGCGCGACTTGAAGACGTTGTCGATGGCCGACGGCAGCGACGA
CAACGCCATGCCCCAGGGGTTCACAGCCGGCATGTTTGAGGCCCTGGGCAATGCCATGTACAATGAAATGCTCGCGGCTGCGGAGCAGAATCGTATTAGC
CCCGACGCGTTCGAGGAGCTGGGCAACTGCCTGTACGCAGAGGCGGCGAGTGTCGCCGTATCTGCCACTGCTTAGGGTCAAGTTGCAGTTTATTATTTGC
TCTTCATGTTGCCGTGGTGTCAAGTAATACATCGCAAATGAAAGGCGTAGCGTTGCGCTCGTTTCGAGTCCGTCTAGATGCTGCAAGCTTAAGCCTGGGC
CTTGGCTTGCCAGTTGGCCAGCGCCTTGATCCCGTCGTTCTCCACCTGCTGAGCGCCCTGGAAGTCGAGCACTTCACCGTC