Description :
From Genome Similarity Track
Location :
Scaffold_227:44125- 45562
Transcript NameFunction/comments
Phypl_g5623hypothetical protein

Sequence
1437 bases(100 bases per row)
ttaaccctttcgcggtgCGAGGGCGCATTCTTCCGCTGTTACCAAAACACGGTGATAAATGACCTTCTAAACGGGCGCATTTTGCGCCCGTTTAGCTTTG
TCCCGTTCTCTACATACCGCGTATTATTACTACCAATCAGAGCAGTGAATGGCAGGGGGCTCGGGGTGGTTTTGGATGGTTCCATCTTCGAGCAGTATGT
TATTGCCTCACGGCCGTAATCGGCCGTAGCCACAAGGCCGCGTCATGGTCCAAGTGTGGCAAAAACGAGTATCGCCGTGGCAGCCAGTCACTTCACCATA
CGAAAGGTAAGACACATGCACTCCACCTTGGTTTCCGTTTCACTATATCAAAATCAACAGAAATGCGCACAAGTTTCACTGACTCGGAAATtaagctgct
ggtgcagatCGCCTTTCAGTTCGAGAGGGAGGGTCTGCGCATCACCTGGGACTATGTGGCCCGTCGGATGAAGACCAAGCGCGCTGGGCGAGAGCTCCGT
CTCCGGCTGGCCAGCCTCAAGGGAAGTACGGGAAGTCGATTAGCGGCTTCCCGCCTTGCTTTTTTAGTGGCCTGACTACGAGTCAGCTTCTAAGCGCGCC
AGGGCTACCGCCTCCGCTCCGCGTTTTTCCAGCGGCAAGTAACGCTAACCCGTTTGCCCCCACACGCCTCGGACGCACGTTCAAGGCCGGAGTGCGGGCG
AGCGAGCGTGAGATGGGCAGAACGACCGCAAAGAACATCCAGCAATCGTCACCTGCACAGCAGGACGATGAAAATGTTGGCGACGTCGGTGACACTGCCG
GCCAGGCAGTCGCCGACAATCGTCGAGGGCAAGGTGCCCGGCgaggccacgacgaccaggGAGCTGCAAGCGCGCGAAGAGCAACAGGTGTGGCTTGCTT
TGTGGCGCAGGTAGTGACAATGCTGTGGCTAATGTTCTAACTAATTGTGGGTTATGTTTGtgatgcaggagctggagactACAGCATGGGCACAGCCGAC
CACGCAGCATCTGCCGGGCGTGGAGCGCGAGGGTGAGGTGCGCGCGGAGGGCGTGCAGCCCGGCGAGTTGCATGTGTTACAatcgcagcaggtgctgctt
gTCCGTTTTGTTGCTAATGCTGATGCCGTTTCTAACCTTGCGGTTGTTGATTGGGTATACGTAGATCTAGACTCAACCCAGGGCAAGCGGTGGAAACTGT
AGCTTCCATTTTTGAAGGTATCAGCGCGAACGATGTTCGCCAGCAAGCCGGTCATACCTATGTTAATACTACCGTCGGGTGTCTCGAAGATACTTGAAGC
CGTCGGGCCGTTCGAAGAAGCGGACGTTTTCCTCGACGTTGGAGCTGGCGTGGGAAACATTCTTGCCCAAGTTGCGCTTACGATGGACGTCAGAACGTGC
ATTGGCGTGGAGCTTCGAAGGGATCTGGTCGCATTTG