Description :
From Genome Similarity Track
Location :
Scaffold_89:4412- 8542
Transcript NameFunction/comments
Phypa_INRA-310PPTG_18881hypothetical protein

Sequence
4130 bases(100 bases per row)
GTAATCGTACAACATGCCACCACAGGACAGATTGGTGATAGGTTCCCATGTAGGCTCATCTTGGTCATCCCATTGAATCTTGAATTCGCGTACAGCTTGT
CGGCCAGTCCTTGTTGACATTGGCATCCGATCGTCGAGAATGGCTTTCACTCCACTTTCCCCAGCAAGTCGATCAGGCTCCCAGCTATCTTCCGGCAGGA
GCTCCTCGTCGAAGTCAAGACGCGACTCCTCAGTTACATCGTGTAACCTAGTCCTCGGTCGGTCTTCAAACTCACATACCGCCTTGAGACGGGAAACATG
GACTACCGGATAGAAGCGATATCCACTCCGATCAGGAAGTTCCAACTCGTATGCATATTCTTCGACCTTGCGCTCAATTCTAAACGGACCATGCCATCGG
TGCGCGAGTTTCTTGGTAAGCCCAGGCTTAACGCGTTCCATATACAGCCAGACGCGACTTCCAGGTTCGAACAGAGATTTAGTCACTTGCTCATTACCCT
CATTGTCGATACCATCTTGACAGGCAGTTTCACCGTCAAATCGTTGAGGCACTGCAGCCTTTTCCTTACGGCTCAGCGTATCATTGTGCTCTCTGACTCT
TCGCTCCTTTTCTGCCGCTTGGTATTCTTTGGCCATCTCTAGTGCAATTTCGTGCTGTCTATTTACTCCTCGTCGCCACGCCAACGCGTCAGATTGCTTC
CCGGAGCCTCGGCGTAACGAAGACGTCATTGCATGCAGTGTCGACCATGCGTCCCATCCGTGGACGAGGAAGAATGGCGTCTCTTTTCTCGTCGCGTCGT
ACGAGTTGTTAATCGCAAATACCATCCGTTCTGCAATCTCGTCCCAGTCTTGTTGTAATGGATCTTCGACATACACTTTCACTGACTGCATCACTGTCTT
GACTGACATTTCCTGTTGGCCATTGGCTTGTGGTCTGTAACTTAGCGTTGCGCGCGACCTGGACTGCATCATATCGGCGAATGCCTGGAACACCTCGCTC
ATGAAGCGAGGGTCGCGATCATGTCGGATTAGGGACGGTGCACCAAATCTTCGGTAAATGCACTCTTCGAACGCTTGTGCAACCATGAGTGCAGACGTGT
CAGCCATTGCCCTTGCTATGACGAAGCCAGTAGACGAACACTGGAACAAAAGAAGCGCCGTATTGCCTCGGCGAGACCTCGGTAAGGGTATAACAAAATC
CATGGACACAATCTGGAAGGGTCGTTCGGCAAGAATGTTGCCCGGAGAGTACCCTCGTAACTGAGGTCGGCTTTTACTTGAGCTGCATTCGGGACATGAC
TTAACATGCTTCTCGACGTCCGCGTACAAGCCATACCCGTAGTAATCCAGTCTCACTCGTTGATACGCCCGGACCACACCCTGATGGCCGCCCTCGATAG
AGTCATGGCAGTTCTGTAGCACTCCTTGGATCATCGTCGTCGGAACAACCAGCCGTAGTTGCACATCCTGATCACGCTCATTGTCACGTCGACGTCTTGC
ACCGACGTAGTAGAGCACATCGTCAGCTGTCAGCACGAATTTGTCGGCGATCTTCATCAAATTCCGAACTACCTTGTAGGCAAGCTTGTCAGTCTCTCCT
CGAAGCACTGCCTTCAGGTTGGACCACCGCACTTCTTCGTCTTGAGCCTTGGCGATGCGATGTCGCCGTTCTTCCTGTACCGCAACGGGATCTATATCAT
TGGCATTTGGTATTTCGGGTTGCTGTTGCGTCGTTGTATCCATTGTCGATTCTGGTGTCTGTCTCTACTCACTTGCTTTATCCTGGTTGTCAGCAGGGGT
CACATCAGCAAATCGAACACGTTTCTGTACTTTCTTCTGTCGTCTTGTCATCACTGAGACTTCGCCACGCTCAGATCGAACAAAATCCGCGAATGTCCGG
CGTTTTGGCAACTCCACAGCATCCAGAATTTGAACGAAATTGTCGGAACTCGCCTTTATGTCGTTGGAGCATGCGTCAATAGATTTGTAAATAACTTCGG
GTATCCTGTTTAGGCTAGAAAGCTCCGCCTTCCTGTCCGAACTGAGCACCACCTTCGACACTTTCGTCTCCAGCGGTTCGCTCGCCAACGAGTCAGCTGC
AGCGTTATACTCTCTCACTACATGTAGATACTTTGTAGACCGAAGCCTCGCTGTAAGTTCTTTGTGGCGATTCAGCAAAGCTATTATCGACTCCTTCCTG
CACACGATCACCCCTAGGGATTGCTGGATTGCGAGTCTTGAGTCACCTACTATTACCAAGTCTTCGACACCGTGCCCTAAAGCAGCTAATACACCGTGGT
TCATTCCCGTATATTCGGCAAGGTTCACTGTTGTGTGCTCAAGATAAGCACTCGCAGCGATCACTATTTGCCATTCGGGGAGTCGCCAAATAATCCACGA
ACAGCTCCCGTAGCCTCCGAACTTCTCTGTTTTAGCTGATCCGTCGAAAGACATGACGAATCCTCGGTAGTCCTTGGGTAGGCGAGCATAGAGCAAGTTC
GGATCCATACGCACTGTAGGCAAGCCTTTCGTCGGTGGCGCTACAGATGCCAACGAGTCCTCGAGGTCAACGAAATTTGTAATCGTAGACTGTAAGAGTT
GAGCAAATGCGCAATCCTTCTCCTTAACCCGCTTCACCTTCAAGTGCCATGGCGATAGCAGTACTGAGAACTGAACAGCTCGACCAAACAGTGACTTTGA
ACGATGTACCCAGTCGAGCGTCGAAAACCGCGTATAGACGTGTAAGGTCCGCCCTGCCAACTGGGTGTAATACACTTTCAGCAATAAGAGCAGCGCGAGC
ACCTCTTTTTCGGCAGTATGGTAATTCATTTCCGCTTCTTTGAGAACTCGACCACAGAAGCGGACAGGATGTAGCGTGCCTTCGTGTTCTTGCATGAGTG
TTGTGCTTAGAGCCCACTCGTTGGCAAAAAACATGATGTGCACATCTTGCCCCTGTCGAAGTGTCGCAAGATAGGTGCATCCGCTACCTTCTGCTTCAGC
GTAGCGAAGCTTCGTCGAGCCACCGTGAGGTCTTCACTGGGACCGAAATCTTCGTCCTTCAGCTGGTATAACGTCGCTCCGTACACCGCAAAATCTTGAA
TAAACCTGCTGTAATAGTTCAGCGCACCTAAGAAGGATTGCATTCCTTTCTTCGTAGTTGGGAACGGCAATTCAGTAATCGCGCCCATCTTCTTGGGATC
TGCTCCGATACCGGCTGGGGACACTTCATGTGACAGAAAGTCCACACACGACTGTACAAAGATGCTTTTCGTGAAACTGACGCTGATTCGACACTCAGCA
AAGCGACTTAACAGACGGTCCAAAGTAGCCAGACAATTGTCGAATGTCTCTCCACCGAAACAAATATCGTCAACGAAAGACCTGTGTTCGAACACTGGCA
CTAGAGTAGACTCGTCGGGTTCTCCACTAACAAACATGTCCGCAATAGGACTGTTAATAAGCTGAGTTACTGGATCCAGTGTCACTGACGCTTCACGGTC
TGGATCAAACTTCGTCTTGGCGGTGGCCAGGTCTGGCGAGACCTCGCTACTGATGCTTCGTAGCTGTTTTGACTGTTCTTCTGCCTCTTGCATGAGCTTC
GCGTAGTTCTTCCAGCCGCCCTTAGGCTGTACAAAACCCCACAGCGCGTTGTCAATCATGCGCTGGTAAATCATCGGTGCGTTCTTAAGGCCGAACAGCA
TTCGAAGCCACTCAAAGTGCCCCACTGCACAGACAACCGCCGAAATTTTCCGCGCCCTGAGTGTCATCATTATAGCCCAGAATCCGCTGGCTGCGCCAAG
AGAACAAAACCAGAGATAGGACTCCAAATCAGTCAGCAAATCATCAACTAGCGGCATGGCATATTCCATGATCGCTGTGATTGCGTTCACCATCTTGTAG
TCGATGCATAACCGGATATCTTGGCCATTCTTCTTCATCACGATTACAATTGGCGATGCCCACTGGCTATCCGAAAATGCTATTAGCCCAGCCATCAGCA
TCCCTTTGATGAGCTCGTACAGTTTCCGCAAGTGTCGAAGCGGCACTCGACGGGCTCGCTGTTTTATCGGAGCATGACCATTGACGTTAATGTCACACAC
AACACCGTATGCAGGCTGAGGAAGCGCGTT