Description :
From Genome Similarity Track
Location :
Scaffold_1356:4410- 5635
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1356-snap-gene-0.1Deoxyribonuclease ycfH

Sequence
1225 bases(100 bases per row)
TGCTCGAGATTTTCCAGGAGACTTTGAAAAACAACTCCAAGCGACTGCCACCACGTATTGTGCTCCACTCGTACGCCGGTGGAGCGGCCCTGGCCACAAC
GTTTCTCGCTCTAGAGCAGAAATCGCCAGGCACACGAGTTTTCTTCTCGCAGAATGTCAAGCAGCTGACGGACACGCGGTCGAGCAAAGCAGCGGAGTGT
TGTGCTGCGATCCCTTTGAGCGCACTGTTGCTGGAGACTGACGCACCGGACCAGGCACCGCTCGCCACTGAAGTCAAGCAGGTCTGTGAGGAGCAAGGCG
TATCAGATTTGGGATTCGAGTATAGAGAGACGCTGTTGGTGTCGTCATCGGGTGAGCTGAACGAACCTGCGCTCGTGTGCGTAGCGTACTGCCGTGCGGC
AGCGATCCGAGGTCTCTCACTGGCTCAACTGACAGCGGCCGTGTATGAGAACTCTTTGCTAGCTTTTGGAGTGAAGCCTCAAGAGTGACTGGAGCTCATG
CTCGCTTTCAAATCGATCAAGTGCAGTTTATTTACGAGAGTGAATCCAGTAGCATTGCTACACGAGTTCACATGGCAGCGTAGTCGAGATCGCTATACAG
GAGGCTCTGCGTCAGCGGGTCCTTGCCTGCTCACAGCCACACAAGGGCACTGTTAGTCATCAACCAAGACCTACCACAATGTAAAAAATCCGTGCCTTGC
TCGAACTTCTTGCTGCTGGTGTTGGTTGCTGCCTGTCGCTTGAACATGATCACAAACACCACGAGCACAGCTGCTCCGGCGACCAGAATGGCAGCCGACT
GAGCACCAACAAGCGCCGAGTCACTGGCATTGCTACTGACTTTGAGCTTATCACTTGCTGTCGGGGTTGCTGAGGTTGAGAGACTGGATTGGGATTCGTT
CTCTTGCTGCTGCTGAGTATCGGAGCTCGCCTTCATTGCCAACGCCTCAGGTGGATCTGCTGCGTTGAAAGCTTGTGCCTCTTGCTGCCCAACACTCGTG
CTCTTGTCAGCGACATCAGTAACCACTGCCAACGAAGAGCTATGTGCTGAACTATTAGCAGCGCTGCCACTGGTCACAGCCAAGGAATTTGCATCAATCG
CGTGGACTGAAGCTGCCAGTAAGGCGAGCGTGAGCGTCACCACGACTGCCCAGATGCGCATGAGCGCTGTGATGGAGAAAGGAGTTCGCGTCGTTGTATC
TGTTGGGTCAAGCGGGGCTCAGTGC