Description :
From Genome Similarity Track
Location :
Scaffold_3869:441- 2296
Sequence
1855 bases(100 bases per row)
TTACTCGAGCTCCATCACTTCACCCATTGAGATCGGAGCAAATTCCGCTGGTAGTAGATAGTCCGGACGCTCAACCACCTTCGTACTCGCTGGCTCCTCG
ACAAACGCAGCATTGCAGAGAGCGATGGCGTGACATGCCTGGCTTGGACTCTTGCCAGCATCCACCAAAGTGACCAGCTCGTCAAACTTGGATGACAGCA
CATCGCATCGAGCAGAAGGGGGAAGGATGGTGCACATCGTCTCCAACGCCACCTTTGCAAGTCGAAGCTCATTCTGGTTCTTCGAAGCGTGTGACACCAT
CGCTGCCGTGTACTCACAGAGCAGACAACCCATCGACATGGATTTCTCGACATCCGCTGGCTTCGCAACCTGGTTCGCAGTCTCGCATTCGTGAATACGC
GTACAGATCGAGTCGACATCTTCGTTGTTCTTCAGGGCATCAACGATCGTATCGTGGTGCTTCATCAGCAATTCGCACTACATAGGACACACGAACGATT
TTAGTAGCACGTTCAAATTGCAACATGAGCACAATGTGCGTACCTCTTTTGAGTCTGGGATCAGTCGGCAGATAGAGTTCATCTCATCGGTGAAAGCCAC
AAGACTCTCAGGCTTGGAAGACATCGAAGCGAGGAGCAGCGTGTTCTGCTTGCAGATCGTGCAGCGAGACGACGACAGGCTTGGGTCCAGGAATTTTAAA
CCCGAGACCTTGACTGATGCAGCTTCTTCGACACTGCTGCAGAATTTAAGAGTCTGGCAAATTTCGTGAGGCTGCTTGCCGTTTTTCAGCCACAACACTG
CAGTGTCAAACATCTTCAAATCCGCATGGCACTACAAACATAATGAGTTAGCGAGAGCCTAAATCATTGAAAAGACGGAAATTTTCTCAGCGACATACCT
TGTCATCGGATGGCAGCAACTCGCAGACGATACCAGCAGCTTCGCGTGCCTGTTGAACTTCATCCGGCTTCTGGTTGAGCGCAAACTCCAAAACACTGAC
GACACCACTGCAGTACGTGCAGGAGTTGTTTCCTTTTCCGGTCGAAAGCGGCGATGCCACGATCTCCTTCGTCTCCACCTTGCTCGCGGTTGCTTTGCAG
AACTTCATGTCGTGACAAATCTGCTTGGGCTTTTCACCCTTCTTCAGCGAATCGATCACCTTATCCAAATCGTTCATTACTGGTCGGCACTGTAGTTCAT
CACACAAGCAGCGCATTAGAATTAGCAAAACAGTTTGATTCACAGAGTAGAAAAATGTGCGTACCTTTGACTCGGACGGGAGGAAACCACAAACCAAGTC
TCCGATCTGGCGAATCTGGTCGATCTGCGAAGGATCTTCTGCGAGAGCGACTTCAAGGATGCTTGCCAGCTGCGTGCAAACAAAGCATCCATCAATAGCA
GACTCCATGGAGTTCTTCACAACCTTGACGAGACGTTGGTCGAAAGCAGCGAGATCTTCGACTCCATAAGCGGTGCTCGACAACGCGTTCGACTTCCCAG
TGCAGTACTTCAGGCTGATGCAGATTTCACGAGGGTACACGCCCTTGTTCAGCTGATCGATGATAATGTCGAGCTTACCCACGTACTGGTGGCAGATGTT
GTCGGGGCCCAAAAAACCGCAAATCATGTCCGCATACTCACGGATCTGGTTTACTTGGTCCGCGTCCTCTTGCAGGATAATCTGCACCAGTGTCGCGATG
TAGTCGCAATAGAAGCACTTCTTGTTATCTTGGACGTCCACCGCGCGATTCTTCGACACGAAAGCAACCATCGCGTTCGTGACAGGTTCAGCGACAGCCT
TCGACTTGGATGTGCAGTACTTCAGGCCGACGCAAATCTCACGAGGGTGCTTGCC