Description :
From Genome Similarity Track
Location :
Scaffold_163:44093- 46598
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_163-snap-gene-0.22Pumilio-like mating protein M90
Pytir_DAOMBR486maker-pir_contig_163-fgenesh-gene-0.15Amine oxidase

Sequence
2505 bases(100 bases per row)
CCGCTTGGAGCGCGAGTCAGCTGCGAGTCACTATTGAGATGCTGTAAGTATGCAACTCGCAGCAACATCACATCGTCGAGTTGAAACCAGGGCGGCGCAG
CCCCCAAGAAGCACAACTTCCAGAACTCAGCGCACGAAGGAACAAGACTGGAAGAGAATATCCGTTTTATGCTTATAAATATTTGACTTAGGTATTCGTA
CATGTGACTTGAGTGAAGAGTGAAGATTTAGGTTGGCATAATGCATAGCAGTTCAATAAATGCAACCACCATCAGTTTCGTGTGACTCCTTAGACTTCGC
AGTGCCCTACGTTATGCCCGTTCACGTCTGGTCACAGAAGCAAAACTATTGGACAAACATGCAATCAGAAAATGTATTCGATTTGTTTGGTTTGTTTCCT
CTATACACGCAATGGTCTCAAAAAAAAGAAGCGCCAATCTGCAGAAGTCTACAACGATGCCGCTACTTGAGCTGCAGCGCGAGTACCCGTGTCCATGGCG
CTGTGCACCGACATGCCCGGCTGCTCGAACGACGTGGCTTCACCCGCGAAGAAGATGCGCTTCTCGATGGCTCGCGCGAGGTCGCTGGCAGCGGTGTCCG
ATTGCCCCACGCGAGGAAAGCTGTAGCCACCGCGGATGTACTCGACGTCACCCCAGTCCACGTACTTGCCCTTGACGAAGCTCGAGCGCGCAGGCGTGGG
TCGTTCCTTCGTGCCGTAGATCATGTCGAGTTGGTCCAGGAACTTCTCAATAATCTCTTCCTGATTGAGAAGCTTCAGGCGGTCCGCACAGTCCGAGCCA
GCGAAGCCCGTGACCAGGTACTGCACCTCCTTGTTGGCAAGAGCTTCCTCAGCGTAGAGCGCCTCGGCAACAGCATCTCCGTTCAAGATGAGGTGGCCCA
CGCCCTTGGAGCTGTTCACCCAGAACTCGGGCAAAAAGCAGTCCGAGCAGATCACACCGTGCGCGTTCTCGGGCCAGAACGAGTTCGTAAAGTGCATCAG
CACTTTCGCCGCGCGACGCATCCCGTACGAGTCCACGGCGTCTGCCTTAGCTTGCGGCAGGCACGGCACGTACTCGATGTCTTTGAACACCGACGTCGGC
ACCGTCACCACCAGGCGTCGGCAGGACATTTGCTCTCCGCTTTTGCTCGTGAGCACGATGCTGTTGGCGTTCGAGTAGTCGATGCTCGCCACGGGCCAGC
TGAGCTGCGTGTCGATGCCCGTCTTGAAATGCTCAATGATGCGTCCGAAAGTGGGCACGACGCGGTAGTCGCCCTCGTCTTCGAGGTCAATCCACTGGCG
CTCGTACTTGCAGGTCACACGCAGCGAGATGTCCTCGAGGTTGCTACCGGCCGTGTTGGCGTATCCTGCGTCCGCGAGCTTCATCATTGACGCCGAGAGA
CTGTAACTCTTGAAGTAGTCCATCATGGACTGGTCATGTGGGATCGCATCCACGTCTTCGATCTCGCTCAAGTGCGAGACCGCGTCGTTGAACTTGCAAA
AGTCTGGGTCCTCGTCATCGAACGCGAGCATGCGCTTCTGGTCGCCCAGGTAGTAGTAGCCAATACCTCCGTCCGGCGCTGGATCAGTCGGACCACCGTC
ACCCTAACAATTCATCAGCAGTGTGAAAATACCAACAGACAGACAGACCGTTAGTACAATACCGTGTAACGAGATCGGCAAGAGGTACGCGTTGGAGAGA
CTTTGAATTTAAATCGTGTCGAATTGGTTGACGTGTTATATAGATTTTGCTTTGCTTTGTGCTTGAAAGTATGTTTGAAACCAGACTGACTTCGCAAGGT
GGACTCATACTAAAACCAATGGCCAAGAACTGGTGACACCGGCAGCATGAATGAAAAGCCGAAGCCTCTCGCCTTGCGATGCTAATTAGGTAACATTTGA
TATTGCATACGTATGAAGGCCAAATGATTACAAGAGCTCGCGCACATGTAGTTTGCAAGCTAATCATAGGCTGATTAATCGATGCGAGACCAGAGCGCTC
GGGTCAACGAGACTCTGGTACTGAAACGGCTCCCCACACATGCAATGTACATAGATCAACAGATGTCTCCTCATTCCACACACACTCGTTCGGTCATCTC
ACCTGAGCCCACGTGAAGATCTCCCGCAAGCCCCACTTCTGCTCTTCCGCGAGTCGAGTGAGCGTCGTGTTGGCACCGTGAAGCAGCTCTGCACCGATTT
CAACCGTCATACCAGGAATGAAGTCCGTGTCTGGAAGGATGCGACCGCCCACGCGGTCCTGCGCGTCCACGACCAGTACGTCTTTCACTCCCTTCTCGTG
CACAAGCTGGTGCGCGCAACGCAAACCTGCGACGCCCGCTCCGATGATCACAACGTCGTGACGCTTCAGCGCACTCATGATGCCTCCTTCTTTTCGTAGA
ACGCTGGACGCCAGAACGTAGCAAATGCTCAATGAGGGATGAAGGATGGAAGGAAGCGACCTGAGGGGCTCATTTCGCGAGCTTTTTAAGCAGACGTCTC
TTTGT