Description :
From Genome Similarity Track
Location :
Scaffold_203:4409- 5551
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_203-snap-gene-0.9Regulator of chromosome condensation (RCC1)

Sequence
1142 bases(100 bases per row)
AACTGCCGCAGGATCGTGGCGCTATCGGCATCAGCCTGGATCGCTCTCAAATAGTAATCGTCCAGCGTCGCGTCGCCGTGCGTCGGCACAGGCGGCACGA
CCACGAGTGTCGCGTCGTTCCCACAGTGCGCAGCGCCGACTCGGCCGACGTAATTAAATGCCGAGTAAACGCCAAACACTTCGACTTCGGCCACGTGCAG
GAAGTTGCGGTTCTGCAGTTGGATGCGCACGTACTGGCCCACGGTCTGCGCCGTCGGCAGCACCCACTCGGTCATTCGCTTGTCCGTCTCGCTGAACTGC
TCAAACGCCGACGCCTGCACCTTGGCGGCGCGCAGTCCCTCCTTGCCCGTGAGGTCCCGACGAAACGGGAACTCGCTGATGAGAATCCAGAATGGAAAGA
GCCGTGACGCAAACTCGTTGCGGGGCTTAGTCGGATTCAAGGGTTCATCCGTGCGATTCCACACGCGAATGCGCTCGATCACGGCCGGCTGCCTTAAGTC
CACTTGCCACCACGGCTGGTCGTCCAGTTGCGTGTGGATGCACTTCGCCAGCACACCATCTACGTCGCCGTTGACTGCGCGCGCAGCGTGCTGCTCGTTG
TAGACGCTGAGCTGGTCGCACGGCTTGTCCCTCGCCACATTGAACGGCTCGACGTGGAGCGACCGCACAAGCTCCGGCTCTGCAATGAACGCGCGCGCGG
GGTTGTGGCCCGTGCACCCTTTGGCGTTACGGCCCCACGTGTAGAGCTCCCCATACGCCGACACGGCCGCGATGTGGGCGACGCCGCACGAGACCTGGCG
GATGGCAACACGGAGCGTCGCCACAAGTGTCCAGGACGGCGTGTGCTTGCCCAGAGGGATGGCGCCGCCACAAACGTACATGTCGCCGCCCTGGAGCTTC
TTGCTGCCGCCTCGCAGCTCGGACGTCGTCTCGGTGCACAGCGCTGAGTGCGCGTGGCCACATGCGACTTGCCACACGCGGACCTTTCGGTTCACCAGCT
CCTTGACAAGCGTCGGCGCGACCACGGCGTCTTGCACGTGCGCGCCGAGACCCAGGCGTCCGCCATTGGCCGAGCCCCACATGAAGAGCTCCCCTTGCGT
GGACACAGCACCGGTGTGAGCGGCACCGCAGGAGACAGACCG