Description :
From Genome Similarity Track
Location :
Scaffold_220:44083- 45580
Transcript NameFunction/comments
Phypl_g5495nucleolar protein NOP5

Sequence
1497 bases(100 bases per row)
TGCGTCTATTCCTcgctttttttcttcttgtgcttcttagccttcttctccttttTCTCCTCCACagcgtcctcctcggcggccttcttcttgtgtTTCT
TagccttcttctccttcttctccttcttgggcttgggctcctcctcgtcctcgtcagcctcctcggccttgcgcttcttgctcgacACGGTCatgtcggc
gtcggcgttgTATGACTTGCTCGTCTCGGTCTTGGtgtacttcttggcctcgttcTTGGTCTTGCCGTTGCTGTTGGGCACGCCGGAGAAGCCGTTCTCA
AGCTGCCGCACGCGGGCCTCCACCTTGGCACGGTTGTCGAAGCCAATGGTGGCCTCCGTGGCGTCTCCCAGAGCGTCCACACGCACAGCCAGCGACGTCT
TGGCCGCTAGCACACGAGAGATCTTACCCTTGTGCTTGGGGGCGGTCTGGCCGATTAGCGAGGCGTGGTAGATCAGACCGTACTTGGGGGTGTCGTGCTT
GGTCTTCAGGGCACGGAACAGAGCCTTCTCAGCACCGAGGATCTGCACGGTGGAAGCCGGGTGCTTGGCCAGGTTCATGAGGGAGCCGGCGTGGGCGATG
AGACGGGCACCGACCAGCTCGCCGACCATGACGGTGAGGTTGGGGGCGATGGCGTTCATGCGGTTCTTCAGGTAGTCAAAGAGCTGGGCGCGGTACTCCG
TGAGGGAGATGACCTGCTCACACAGAGCCGAGATGTTGGTCACGTCCTCCTCGGAGATGTCCGTGCCCATGGAAACCTCGCAGACCTCGCGCATGGAGGC
CTCGACGTCCTCCGACAGGATGTCCGAGAAGTCGAGGGTCTTGACGCGGGTGCGCATGCCCATCTTGAGCACGCACTTGGCGTACTGCAGGTTGTCCGTG
ACGATCTTGCCCATCTCGGGGAAGTGCCAGCCGAACCACTCGCGCACGCGCATCGAGTACGTGTTGatctccttgtccagctcgtcgagcagccCAATGG
CCTGCACGATCATGGTGTCCACCTTGTCGGCGCTGAACTTGAGTTTGTAGCGCGAGAGCGAGTGCGACAGACCGAGCGTCATGGccttgaggtcgtcgtc
ctccaggCCGGTGATGAGCGTGTCCATGTTGGCGCGGATGCCGCGCATGACCTCATTCACGGCGCTGTCGTTGACGCAGGCGAtgctgagcttctccttg
atcaTCGAGCCAAGGGCCTTGTCCGACACGGCCAGCTTATCCTTGAGgccggcgtccaccacgttcttcttgaggaacttcttgagcgccttgcccatct
tgccgtccaccatgtcggtggcggcggccacggcctccgTCGTGTCCTTGAAGGCATTGAAGCCCTTGAgcttcagcaccttggcggccttgtCGGGCGT
GGAGAAGTGCTTGtacacgtcgtcggcgctggccaccTTGGCCTCATCCTGCACCTTGAACAGCGCGTGGCCCGCGGCCGTCTCGAACAGAACCAAC