Description :
From Genome Similarity Track
Location :
Scaffold_7:4408- 7146
Sequence
2738 bases(100 bases per row)
CAGGCGCAAGCGCCTTCTGGTCCACGAGAGAAGGATCATGATATGTCTTAAGCAAGCCAACGTAAAACACTGGGTGTGTGCGCAACTTGCGCGGGAGATT
GAGTGTATAGTCAAGGCCTTTTTCCGCGATGACCGCAAACGGCCCAATGAAGCGCGGATGCATCGTCTTAAGGACGGCAGAAAATACATTTGTAGGTAGA
TTTTTAGCATTTAGTAAGACTTGGTCTCCAACTTCATAGGAGTCAATACATCCACTGCCTTTAGCATCAGTTCGTTCTTTTTATTCGTCTTGGCTATCAT
CCATTGTATCACGCACATGTCGTAAGACACTAAAGCGCGTCGTGAGAAACTCGCTCACTTGTTTCTGCATAGTGGTAGGGCTGATGTCAGCAAGCTTGTC
AGCAGACTGTCCCCCACCAACGGGGGGGAGTCTGCACGGAGTGGTAACGTGAGCGGAATGAGGGGGTGCGTGAAACTATTCACATAGAAGGGATTAAAGC
CGGTCGAGGCATGAACAGCGTTGTTCAACGCACACTCAATGACAGGGAGCATCGAGCTCCACGTCTTAGGCAACTCAGCACAAACACTGCGAAGAACGTC
GCCAATGACGCGATTAACTCGCTCAGTATGACCATCGGTCTGCGGATGATCCGCTGTGGACATGTCCAATCGCGTACCAAGTAACTTGAAGATAGAAGTC
CAAAACTTGCCTGTGAAGCGAGGGTCGCGATCAGAGATGATTGCTAGCGGCGACCCGTGTTGACGAAACACACGATCGATAAACAGCATAGCTGTACCTT
TGCCATCGATGGAATCCGGCACCGCCGCTAAGTAAGCCATTTTGCTTAAATGGTCAAAAAAGACCACAATTCCCGTATTGCCGTCACAGTCTTTGGGAAG
GCCAAACAAAAAATCCATACTGATGGACTCCTAACACCCCGTGGGCACAGGTAAACTGGCGAGAGGCGCAGCCGAATGTTCTGAGGGTTTGACCCGCTGG
CACGTTTCGCATGCACGCAAGTATGTGCTCACCCATTTGTAGATTTTGGGCCACCAGTCGTGTCGACTCACAGATCCATAAGTCTTTTCCCGGCCCAAAT
TCCCCCTGCGGGCCGTATCGTGGTCCTCAAAGAGAATTCGGTTCTTTAAATCCTCATTGTGAGGCACAACAATGCGAGCGGTATCCGCTACATCTGTGCG
ATAGCAGAAGAGGCCATCATCGATGGAATATCGATGCAGGCTGGCCTGCAAGCGTGCCGATAATTGACTGTCAGAGTCCTTGTATTCCTCACTCCCAAGG
GCATGAAACAATGCCACATATTGAGGACCCCTGAATAGTCCACACGAATTAGCTCCTCAATAGGAGACGACAAAGTCGTGGCATGAGCAAGCTCACAATC
AAGTCGGAGAGAGCGAGCATCTGCCAACACATTTTGTTTGCCTGGATTATACTTCACCTCGAAGTTATATTCCGCAAAGAACAAAAGCCAACGAGCCATT
CTATGAAGAGGTGAGGCGACTGTGTCGCCGTGCGTAATGATGCATGATACGTATAGACGACGAATGGCTTGGATCCAAGTAGATGGACTCTAAATTTGAC
GAGCGCATACTTCATAGCAAGTAGCTCTTTGTCATGAACTGGATGGTTCTTTTCAGCAGCTTTCAGCTGACGTGATTCAATGGCGATAACTAGAGAGCGG
CCTGCAGCATCTGTTTGTATTAGAGCGCTGCCAATGGCAAAGTCGGAAGTATTGCAGACAACACTGAAAGGGTGCTCAGGATTTGGCAACGCCAAAATGG
GAGCATGGAGGAGACTCTCCTTTATTGCTCGAAATGCGTCGGCACGGGTGTTGTCCCAGCGCCAATCGGTGTCCCTCTTAACGAGATCATTTAATGGCTG
GGCCATATCAGCGTAATTTTCACTGTATCTGTGTAAGTAATTGGCAAGGCCAAGCCACTTACGCAAGTCCTTTTGATTCTTATGAATCATCCAGTCTATG
GCTTTGACCTAAGCGGGACCCGCTCGAAGGCCGCGCTTACCAATGAAACATCCTAGAAAAGGAATATCCCCTGAACCAAAAATACATTTAGACGCGTTGG
CGTACGGTTTATTAGTGCGCATGTACTCGAGCACGGCTCGCAAATGACCGATATGATTTTCAACATCTGACCGACCTTTTTCGGCACGAACATTGACAAA
AATGTCATCAAAGTCCGTGCGTAATCCCGATATGGGCGGAAAACTTGCGTCGCCAGACGATTAAATGTTGCCAGAGCATTATACAGCTCTTGGGGCATCA
CCAGCCATTCCCATCGCATAACACTCGGAGTGCTCACTGCTGCAAGCGGAATGTCACTCACTCGCATGAGCAATTGATAATATCCATCAGCCAAGTCGAG
TGCGCTATACATAGTACAACCAACCATGTTGTTTTGAAGAACATCCTTTCGAGGAATGGGTTTCAATGTCGGAATATTAGCCACATTAAGCTTGTTATAA
GCATGCTCAATACGCCACTTGCCGTTAGGCTTTTTGACACAAAATGTCAGTGTCGAATGTGGAGATTTACTCTCACGAACCATTCCTGCCTCGTGCTTAG
CACGGAAGAAGTCATCAATGACATCACATTGCTTCTTAGTCAAGGGCTACTGTCGTGTGACATAGTATTTAGTCCCAGGAACTAAGTCAATTTCATGACG
GACACCTCTATCTGGAGGTAGAACCGAGGGTGGATCGT