Description :
From Genome Similarity Track
Location :
Scaffold_112:44074- 45196
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_112-snap-gene-0.28Deoxyribonuclease ycfH

Sequence
1122 bases(100 bases per row)
ACGCAGATGAGAGCGACCCAATGCAGCAGTCGCTACTGTACCATGACATGGATTACGCGGCGATGTAGCGCATTGCGGAATATCCACACTGAACGGAGAT
AACAAACAaGGATGCGAATGATGCATGTGGAaGGCTGTACTTGGATCCTAAGAATCGAGGCGGAGCGCCAGTACAGAGTTCTTGTACACCTCGGCTGCGA
GATCCTCAGCGACCATGCCATAAaTGCGTGCAGCGCGCTGAATTGCTAACTGGACTAGACACGGATCATTCAGGCCGCCTTGAATCAACGGCATCTCGTC
TGAGTTCTCATAAAACTCcATGGCTAGCGACATGGGTGGAGGCTGGTCTGGAGCGTCCGTTTCAAGTAGCAAAGCATCAAGAGGGACCTTTGAGCAGACG
AACTCGCCTTTCGACGGCTTCGCTTCCTTGTCCTGAcTAGCAGGACCGGAAAGCTGCTTGGCGTTCAAAGAGAAGAATACCTTGACGTCAGCCTTATGCT
GCAACGCTAAAAAAGCCGTCACCATATCTGCTGCTCCCGAGAACGAGTGCAGAATGATAATGGGCGGTAGCCTATTCTGGCGCTTTTCTGTCTCAAGAAG
CTCAAGCAGCTTTCCATAGGCGCCGACACAATGGATGACACACGGACGCAGCAACTCGGCAGCGAGGCGCAGCTGATCCACGAACACTTGCTCCTGTACA
CCGCGGTCAACTTGCTTCCCACGTGCGCTCTTGCACAGACCGATCTCACCGAGCTGTTAGGTGAGTCATTTAGTtGATCAGAtGGAAGACAAGAACgAaG
GAGTTCAAGAAGCTCTCACCGTTGCTTCCGGATGCCTGGTCAGTTTGTCCCGCAGCAGGTCAAGATATTGGTCGGACTTGGCGTTCGCCCACCACGGATG
TACACCGAACGACGGAACAACGGTCACGCTCTTTTTtGCTTTCGTTGACTCGCCAGCATCAGTGGCTTTGATCATGGAGAGGAGCCGCTCAAGCGTGTTC
CAGTCATCCTCGTAGCACGCACATGTTGCGATGTGCGTCAGATTCCAGGCTGCCGCTCTGTTCAACACgaCGTCGACATGGTCCTCCAGGCGGGCATCAT
GAAGGTGGCAGTGTGCGTCTAT