Description :
From Genome Similarity Track
Location :
Scaffold_1:440596- 441935
Transcript NameFunction/comments
Aphas_H257_00163choline/Carnitine O-acyltransferase, putative

Sequence
1339 bases(100 bases per row)
CGCCAGCTGGAGGAACGCATCCGGACTCATCTTGCACGTTTTCGTGATCGCGGCCTTGCCGTACTTGCGGTGGTTGAGCACGCGCAGGTCAAAGTTGGCA
ATCGACGCGGCCGCCGTCGCCATGCACGCCGTCACAGCGTCGTGGAGCTCGGGCGTCCAGTTCCACTGCAGCTGTTCGCACCGCGGCAGCGTCACGTCCG
ATTTGAACGACGCCGGCTTCTTGCAACGTCCATCCACGTCGTACGGTTCGTCCAGCATTTCCCGAAACGACACTTCTTCCCACAAGTGCGCCATCACCGG
CGCGTCGGCCCACGAGTGCTCGACGTTGTGGCCCACCTTGCCGTTTGCAAACGCCACCATCGTGAACGACTTGTCAAACCAGCGGTTGCCGCCATTCCCG
TGGATCAGCAGCTTGCCCTGCTCGTCCAAGTCTTCGGGGCTGGCGTCGTCCAGCACCAACACAAACACGGCCGACTCAATCACGCGCAGCGACTGCCGGT
TCAGTCCCTCCGAAAAGAACGCGTCGCGGTGCTCGGCCCACGTCGTCCGGTTCGCGCTCGTGAGGGCCCCGAGGTACTGCTCCTGGACAACGTCGTCTTC
CGGGGCACACGCAGACGACACTGCCACCAGCTGCTGTTCAATCTCGTACGCACTCAAGAGGTCGCCGTGGGTGCCTTTGCGGAACAACGGCACTTTGAAC
CACCGACCCCGACAGTTCACGGCCAAATGTTTCGACGAGTGGTACTTCTTCAGCGTGTCTTCGTCGCGGCCGGGCAGCCGCGTGGTCGAAAAGATGCGCG
TGTACTGGGACATGCACAGCGGCACCAGGCCGCGCAGCATGATGGGCGCCAGCTGCTCTCGATCCAGTTTCTGCTTGAACTCCATGAGTTGGCGGACGAC
CCCCGCGGCGCGCGCCAACTGGTTGGTCGATGGGATGTACCGCGCTGGAAGCACATAGTAGTTGCTGCCAATCATGATTGACGACCGGCCTTTCAAGTAC
ACGTATTGCTCCCACCAGTCGGAAATGTAGTTGTCCGCGTACCAGCTCTTGAGCACCAAATACCGCTGCAGTTTGGGCCCGGCGTTGCCTTCAAACTCGG
CGACAAGTCCTTCGATGCGCTTGTATTCGTCGTCCGAAACCAACGGGTGGATCGATTTGAGATATCGCTCCAATGTGACCTTCAACGGCGGCACGGACAT
GCGCGGCAACGCGCTTTGGAACGAAAACGTCAAGGGCGAATGCCCGCCCAACACTTTGATCAATGCGGCCCACGCGGTCACGGCCATGGACGTTTCCTTG
GGAGCCAAGTACAACCAGCCGCGGTAGCCCAAGAGAGCG