Description :
From Genome Similarity Track
Location :
Scaffold_13:440545- 443515
Transcript NameFunction/comments
Phyin_T30-4PITG_08265Putative uncharacterized protein

Sequence
2970 bases(100 bases per row)
TTGTGCATGAACAGTCGAGCGGATGCGACATCGTTGCGTAGACTTGCACTGTGGAGTGCTGACCGTCTGGGCAGCTCAGCCAGATTGAAGTCGAAGAGTG
TATCGACTGACGAGATGCCCGTGTAGTGCGCCATTACAAACGACTCGGCAACGTTGGGCGTGAACGTCACAAAGAGAGCGGGCTGCCCGTATCTGGCCTG
GTAGGCAAATGCGCGACGACGACACTGTGCCCGCTCGGCGTCACTCCCCCAAACAACACCGCTGCTGATCTCAACTGTCTTCAAGAAGTCACTGTCACCG
GAACTGTCGTCGTGTATCGCTGTCGCTCGACCTTGGCGGTGCAGCTCTTTTTTTTGGAGCGCTTCTATCAACGAGGCTTCGGAGATGGCACTGTACCGCT
CGAATCGGGCAGGATCGCGTTGGCATTTGAGCGCAACATGCAGATACATGCGCTGGAGAGTGAGATGGTCAAAACTCACTAGTGTGAACAGCTCGTCTTC
AGCGAATCGTCGCGTACTCAGCTGGCTGTAATGACGGATGCAAGCTTCTAGTGATACTGGAATCCGCCGCTGCTCGTTTGGATGACCTCTACCGTACGGA
AAGAGGTGTGGGAACATGCGCGCGAGCAGCAAATTCTTCTTGCCGGCAAACCGACTTGAGTGTCGAACCAAAAACTGAGGCTGCGATGTGTTTTGGGTCG
GCAGCTCAACAACTTGAACTGGAGTAGGTGATATGTCCTGCGTGATGACTTCGCGGTCGTCCGTAATAAACACCACGCTATGCTCCACGACATCGGTCTC
TCCACCGGTCCCACAACTCCTAGCGACGCTGCCCACACGATTGCTCTCAGCATCGATATCGTTGACGTCAACGTCGACATCGATCTCCTCGGAAATCAAG
TGCTCTGCCACCGTTTCAACCGCTAGACCTGAGCAATTAATGGCAACGTCCTCATACAGCGCGTTGTACTCACAGTAGAAGGCCAGTAAATCTTCAACCA
ATTGACGACGAACGAGGTGCATTTGCCGAATGCGAGCTTGTTGCTCGGTAGTGAACGGACCTGCCATCAGGACTCGGTAGCAGCTGATGTTGCGGGCGGA
TGTGGGCAACAGCGTCACAGCGGGGCCCGGCATCGAGTCGAATGCGAGACAGTGCGAGCGGATTGCGCGATGCGCGCCACCGCGCATAACCCGCGTCACA
GCAACGATCGAGACCGTCTGCGTCATGAAACGCTCCGGTAGCGTAGCACTGGCGAGATGACTCGGCAGCGAACCAACATAAAACCCGTTCTTGATAGCAA
ATTTCGGCAGCAACTGCTTCGCTAAGCTGGTATTGCATTCTCCACACACTTGAATGTACCCAGCTGGATGAACACCGCGTTTTGACAGCAACATTCCACC
TAAACAAGCAAACAGCCCCGAGCAGTCGTACTCGGCTGTTAAACGTGGCGGCAAGTGCTCGTCGGTACTGGACAGCAGTATTTGCATCTGCTTAATGCGA
TCGCAATCGTCGCCAACTGAAACCATGGTCATCGACTTGCGCAACTTCATGCAGTCGCACACGGCGCATGTTGCATCATCGAGTCCGGACGGCCCAAGTT
TCAATCTTAATCGATGTAAAACCTCTTCTTTCGTACTCTTAGTCACGGGACGGAGAGTCGGAGCACCACCGTCTAGCCAGCTTTGATGCGGTTCCCCATT
GGATTGACATTGATCCTTGCAACCAATAGCCGTACGGGCACGTTGTTGTCGCTCACGCTGTCGGCGTAGTCTTTCGGCTCTCTGCTCAGTGCTCTCACGT
GCTCGACTACGTTGAACAGCGAGCCTGTGTTGCTCTCGCCGTTCTTCAGCGCTGAAGACCATAAATCGTGGCCAACACGTGAAGCTGTTGACACCAACAC
AAGCGATTCTTGTAACTTTGGGAACCGACTAACAACAGCCCACAACTCGGATAGCTAGCGACCAAACTTACACTTGTACATGCTCACGTTCGCCTCAACG
ATTCGGACAGTCTCGAAAACTACTGGGCATTGCTCAGTCCTAACGGTGCGAAATAAGTTTGGTTCTCCAAGTGAGGTACGACGCGCGGGACAGGCATACC
GTTGTTGAGCTATGCTGCACGACATTGTCCTCGTCGCAAACGTTTAAGAACTGATGCTCACAACATCATATAAAATCTTGCTTCGATGCTCCATGCTTTC
CGCTGCGATCGCCTTGTCCCTTTCAGGAGCAAACGCGTGAACAGACCACAGAGCACACACTCCATTCAGCCCGAGCCAGGATTCTCTTCTTCCGACAGCA
ATGCCACCAAAGAAACAGCGCGACAAAGACGCAGTGGACAAGCAAGTACCGGACAATGTGATGATCGAGCCTCGGTCTACGCCGACAATGAAACACGATC
CAGTGTTAGTCATGAGCGATCACCCAACGACCAGCTACCAGTCGCCCCTATAAGGCTCGAGAGCACGATCGAGAATCACAGCCGAATGATTTTCGATACA
GTCGACGGTACGTACGTAACCGGGTTAAAGCTTGGCATGCATCACAACGACTATTCTAGATTATTAACGAAGGGAGTACTTGCTGCCAAATAGATCTGCG
CGAGTTTATCATGCACAGCGACGGCAACGACAAGGAAGTGTGCGCGTCCGTGCGCATCAAGGCGCGTCTTCTTTGGATGGCGTCCGACACAGTCCGAGGT
CTACGCTTTTTACGACTCTACTTTGGCGAATGCCAGGCGCCAGAATCGTTGCAGCAGCAACAGCAGGTAATCAACCATAGACAACACGAACATCTCGCTA
CACTCTCACATCGTATATGCGTCAGGCCTTCAAGCAAGCGCAACAGGACGACCCATTCGAAGCAAATCAATTCCTCATCTCTGTCTCGCTACTCAAAGTG
AACATCGACGACCCCAAGCTTCCACGTCCAGGAGATGTAGTGATGATCACACCGTTCAAACTCAACGTCT