Description :
From Genome Similarity Track
Location :
Scaffold_420:4405- 6816
Sequence
2411 bases(100 bases per row)
CTGATCGCGCCTCGAAGTTAACTTCGTAGATCACGCAGTTACCACCGCTGAACCAAAAGAGGTTCTAGTATGATCTGCATAGTGGAAAAATCAAAAAGAT
CTGCGTACTCGTCGCGGACGATGAGCACGTCAGTAATATCCGATCGGAAATGGTCTTTGCCAAGGATGAAAGAGTTCTCAGTAGCTGCTCATAAATGGAC
GAGATTGTTCTTAATGAGAAGACTCGGATTGAGCTATATACACCCCAATCGTGATAATAACTCAAAGCAAATCCTCTCTACGATGATTTTATAGAATTCA
GGTATGTATTCCCAGATACAGTGCCGTTCAAGATAGCTGAGAACAAACGTACTCGTCACGAAAGCGACCTGAAACCGGTTCCGAGATACTGTGTTATGAA
GTAGTGGTCATTGCCTCGCGAAAGTACTAGCGATCGACAAATTCTTTGCAGATCGCTTAGTGGTCGGCCATTTGATGGAGTCGACCTGCCTACTAGCGAT
CGACAAATTCTTTGCAGATCGCTTAGTGGTCGGCCCATTTGATGGAGTCGACCTGCCTACATAGCTCTCCGACCTTCTGTGTGCGGAAAGCCGGAGGGCG
GTGGTGGATTATACATGCCTTCAGCTAGTTGAATGCTGCAATTGTACCGGCTCAAACACCAATACCAAGGAAAGACGTCTTCGTCGATGGTATAGCAAAG
AGTACCGTCTTTTTATCAGTGAATATGATGGATAAATTCTATCAGATCCGTATGCGCAAAAGTGACATTTTCTATGCTGCAGTCAGCACCCCACGCGGTA
TGATTTGGGAGTGGCTAGTGATGCCACAAGGGATAAGTAATGACCCTGCCACATTCAACAGATGTGTGACAAATCTATTGATATCTGTACGAGAATTCTC
ACTCAGCTACTTCGATAATGTTCGTCCATATTCGGGCTATGGAATGACAGACGGATGTGCAAATACACCGACTCCACATTAAGAAGGTTCTTACACTAAT
GTGCGAGCATAAGTTGTACGCTAACCTTAAGAAGTGCATATTTGCTGCTAGCGAAATACCACTTCTTGGTTGCATCGTGTGTAAGCATGAAGTCCGGTCC
GATCAGGAAAAGATAAAAGCGACCTCTGGTTGGCCGGTGCCTACAGATGTCAAAAGACTTCGAAAGTTCGTTGGCCTCGCGGCGTATTTGCACAAATACT
CGCAGAATAAGCCGAGACGACTGTTCACCACTCTCGTTTATCAAACAATACCAGAAGTGGGTATGGAGTGCCGATTGTCAGCGCCCCTTCGAAGGTATAA
ATCAAAAATTGATACAATCGCCAGGTTCGGCAATTGCAGAGCAAGACAGGCCATTCCATGTGGTCTGGGATGCCAGTGACTTTGCAATCGGCTGCGCACT
AATGCAATAGGATACAGACGATGCGGAGCGTGTCGTCTGTTATCACTCACGCCAGCTGCAACGAGCAGAAAATCAACTACCCCGTCCATGACAAGGAATT
CCTGTCATGAAGTACGCATTGGCAAAATTCAGAGTCTATCTGCTAGGCAATAGACCCTTTATTGTATTTACGGATCATGCGTCTTTGCGCATTGCCGTAA
GCAGTCCATCTCGCAGCGGATGGCGATATGGCTGACATTCTTCGCGGAGTATAATTTCTCCGCCAAAGATAATCCAGGACGACTTGATATCGTCGCTGAC
GCACTCTCGCCCGGCCAAATTAAGAACCGGCTGCGCCACCCGACAGTAGTCCGACCACTGTTGCAGTACTGACTTCGATTGTCCCAACGGCAACCTTCTT
GGACGACATACGGAAGTTTTATGATCCGAAGATGGTGTATTGATGAATCATCTCTCGCACCCGTCTCAACCAGCTTTCGGAAATATATCGATCCTCAGCA
GTTAGACATACAATTTGCCACGCCTTTCTAAATATTCAGCTATTGTTGGCGACACGCCCCGTGTGTCGTACCAAGTCATGGTGATCTGAGTTGTGAATCA
TGTATGAAAACCACGACGCACCTGTTTGTAGACATCTTGGTCGCGAGAAAACATATCTTACGGTGAGCCGAGACTTCTACTGGCATCGCCAGTCTCATGC
ATGCGAGATCTGTCAACGTGTAAATTCTAGCCCTTGCCTTCGTTCCCGGTTGCATCCTCCGATTGTCACGAATGAGTGCTGGAAAATCGTCTAATGGATT
TTGTCTTCGGTTTCCTCGCTGATACGCACAAGAATACTATTATTCTTGTGTTCGCTGACAGATTCAGAAGATGGTATACCTGATCGCTATGCTCGAATCA
ATTAACGCATCGAGTTGTGCTCGTGTATATATCGACACGATCTTCCGACTTCATGACCTGCCTCGTGAAGTCGCGTTCGATCGGTTGCGGCGATTCACAG
CTGAGTTCTGG