Description :
From Genome Similarity Track
Location :
contig_38:440263- 445494
Transcript NameFunction/comments
g8413.t1hypothetical protein
g8414.t1RAW41934.1 hypothetical protein PC110_g1887 [Phytophthora cactorum
g8415.t1XP_009515415.1 hypothetical protein PHYSODRAFT_343735 [Phytophthora sojae
g8416.t1OWZ23553.1 U4/U6 small nuclear ribonucleoprotein Prp31 [Phytophthora megakarya

Sequence
5231 bases(100 bases per row)
TGCTGAAAACAGAACACAGGGAAGGCGTCAAAACGTCGCTCGACAGGTTGCAGACGTTGCTGAAGCTGATCCGGAACGAGCAGGACTACTATCGCGCACG
AGTACACCGCCATGTGCAGAGTGAGTTGCGACGTTGACTAATTCGTGTGAGGTTGTTGTAACTGCATCGACTAACGGCTCGTTCATTGCTATTGCTGTAT
TGCAGCGCTTGAGAGCAGCAAGTACCGTCTCGTCTACTACACGATGTTCGAACTTGCTGTGCTGGGCGCCATGTACGGTGCACAGTCCTTCCTGCTGCAC
AAGTGGTTCAGCGACCGGGGTTATCTCTCCAAGCGCCAGTGGGCATAAACTGCATGATGGCATCACGGCATAGATTAGTGGCAGCTTGTAACTACGTCTC
AGTCTATTGAAGCTGACTGACTGCAGTGATAAACTGCCAACAACCCGAGCAAAGAGCCATACTGGAGTAAAAAGCAATGGCGATAGAGATTCTCAACACC
AACATACTTTTTGAATCGTGCTTCGCTTTATTGGTCCACAGCCTCCAGCATGTTTCGCGCTCGAGCACTTCGCTAATAGTCCGAATCGTCGCTGTCGATC
TCCATCTCGTCAATAATCTCTTGGCATCGAGTTCGAAGCTCAGAGGTGCTTGCATTTCCATTAGCAGACACCGAGACTAGGAATGCTGGCCCGCCAACTC
CAGAAGTATCCTTGACCGACAGGTAAAACACCGTTCCATTGCTTGGCTGCAGTGCAGGTACGAAACGATACCGGCCCTGTTCCTCTGTGAGGATGCCCTG
GATCGGGCTCAGGTCGAGCAGCTCCCGCACTCGTGTCAACAAGAACCTATCCGACGCCACCACCACCTCAGAAGGGCCGGGAACAGCGCCCTCTTCGCCC
CTTCTCACAGCTTGGAAGCTTCCTTTCTGGAAATAAAACACTCGGAACGGTGAGCGTTTGGTGAGGGGTTGCTGTGTGCCGGGACTGATGCACTCCAGCT
CGATGAAGCCCGCGATCGGACCGACAACGTTTGGAACCGGCGCATCCACTTGCACCCGTTGCCCCGCACTGAACGACTCGACTGTCATGGAGAAGAAACT
TGCTTCTTCGTTGCCCAGTCGCGCGCTGATCTTGGTCGGGCCCAGCATGATTTGCGAGTGGTTCTGCACTTCGATCACCAGTTGACCGCGTGCGCCGTTG
AAGCCCGAGGAAATGAGCAGGTTCTGTAGCATGGCGGACTCCATCACGTCATTCATCATGCGCATCACCTGCGCGCTCTGCGATAAGCTCTGCCCCACGC
GCTCGAAGACCGACTCAAACGACTGCTGCAGTCCTCCGGTGTAGCTTTCCAGCATCTTGGCCATGTCGTCCATCGCTTCAGTTTCAAAAATGGCGCGGAA
AGTTTCGTGTTTTACAGTCGGTAGTAGACTTGGCTACATTTGACTGCGGCAACTTGCAAACCTTACTCAATGGAGTTCTCGATATTTTTCTAGTCAACCG
ACTCATCCTTCGTTGCAATAAATTACGATTGGGTTCTAATGATGAGGAAGTCACCTGGCGTTCTACTACGAAATCCAGTCGTCGAGGCGCAGCTTGGTCC
TGGCAGACTTGGGCGCAGCGACCTTGATGACTTATCTGCGGCCGTAGCCACCACGGTTACCACCGCCGCGGCCACCTCCACGGCCACCACCACGACCGCC
AGTCATGTTACCGCTATTGTCGCGCGTGTACGGCGAAGGCTCGATGCCAGGTACTCCCAGGAGGTTCATCTTTTTGAGTGTCCTCTTCTCGAGCTTGGGC
ACCTCGTCCAGACCGATCATGTCGCTGTATTCGGCCGCAAGTTGCACGAGCTCCACCGACTTCAGCTTGAGACGCTTCGCGTTCGAGTTGTAGAAACCGA
GCCACGCCTGGTACGACTGCTGCGCCGACTTCTCCAAGTCACCGTGGTTCTTCAAGTTCTTCATGACGTTCAACGTGCGCGACTGGGACGGCACTAGCTT
AGCCGGCGAGTAGTTCTTGCTTGGCTCAAGAGGTAGGTCAGTCAGCTGGTTCAATAGGGTCGTTTCAAACTCGGACAGGATAAGCACACCCTTGCCCTTC
ATACCAGCACGCGCCGTACGTCCAAGGCGGTGAATGTACTGGTCACGGTCAGTGAGACCCACCTGGAGCACTAGCGACACATCCGGGTAATCTACGCCAC
GCGCCGACACGTCCGACGAGAACATCATGACCTTGTGGCCCTTACGGAAGGCCTCAGCCGTCTTCGTGCGCACCGCTTGACTCTTGCGTGAGTGAATCTC
AAGCACACCCGGGAAGCCCGCGGCTTGGAAAAGCTGGGCCATGAACTGCGCCGAGCGAGCGGTAGGGAAGAACAACATCACCTTGTACGCCGGCAACTTC
ATGTGCGCAGCCAGCACGTGCTCCATCATGGGGACCAATTCCTTCATCGAGCATACAATGTACTCCTGCTCCGTCTGCGCGTTCGTGTCAGCCTCGTTCT
CGTCGATCGTGTCTACGAACGCGTAGTCCGAGCGCAGAGCCACACGCTTGAGCTCCTCTGTCGAAGCAGGCAGTGTGGCGCTGAACAGCAGCGTCTGACG
CTGCTTCGGCAGGTAGCCAATGATGCGCATGACATCCGGGCGGAAACCCATGTCCAGCAGTCGGTCAGCTTCGTCCAGGATCAGCACACTGGCCTTGCCT
AGTCGGTCAGCGATCCTGCCAGTGTTCTGCTTCAAGTGGTCAACAAGACGTCCAGGAGTAGCGACAAGGATGTCAATAGGCGCGCTGCTCGTGAGCGTGC
GTTCGTCCTTCTTGATGTTGGCACCACCCACGAAGCAGGCCACGTTCAGCTCGTGGAACTTGGTAAGGCGCTTAGCCTCGGTCGCGATCTGCTGCGCCAG
CTCGCGCGTGGGCGAGATGGCAAGCGTTGGGATCGTGCCCTGGCGACGTCCCTCCTGCACCATGTTCTCGATCACCGGCAGCAAGAAGGCCATGGTCTTG
CCGTTGCCTGTCTTGGCCTTGGCCAACACGTCCTTGCCCTCGATGATGAGCGGGAACGTCTCGTTCTGCACGTTCGTGAGGCGCTCGTACTTGAGGTCTT
CGACGATGGCGCGCTTGGTCTGGGCCGAGATGTCCAGCGACGCGAACAGGACGTCCGACAGGTAGTCCAAGTTCGTGGGCTTAGAGGCCTCCACCGGCGC
AGCATCAATGGGAGCAGGAGCCTCCTGCGCCACCGGGGCAGCGGTCTCTTGGGTCTGCTCGGAGTTCTTACTGCCGTTGTTGCGTCGGCCGCCGCGACGC
GGGCGCTTCTTCTTGTGCTCGGCGTCGCTGTCCTTGCGGTCGCCGGCGGGCGCCTTGCGGCGCCAGTTGCCGTTGTTGCTGTCGTTGTGGTCTTGGCCCG
GCATCTTGAGTTGACTTGGGTGCGTGCGTGGCCGCGGGAGAAAACTGAAGAGTGAGTTAAACGGCCACAAACCAACCGAAACGTGTCCTTTCGCGGGCAA
GACAAGCCACTTGGCGTTTGTATGCTCATTGAAAACTACGATATGGCATACTGCGACAGTTTCTTTCCATTGATCTCCCGATCTTCCACTTCACAATATG
CCACAACACAGTTACCTACTCATGAAAATCCAAACACAATTAATTTTAAATACTTGCAGACATGTCGACGCTGGCCGACTCGTTCCTGGAGGACCTAGAC
GAGCTCAGTGGGGGCAGCAGCGACGAGGGGGAGACGCCCACGCCTGTAAACGCAGACGAAAAGGCCGAAGACGGAAATGACGCCGACGAGCTGATGCCCG
ATGCGTCTCAATCGGCCAAGAGGAAGCGCCAAACGACCGAGGAAGAGCTGCCAGACGAGAAGACCCAGGACTTCGCTCAGGCGCTGCGCTCAAGCGTGAA
GCAGCGCGGCGTGGCGGCCGTCGCGACACTCAAGCGCTCACCCAAGTACCTGGCTCACGTGCAGGAGATTCAGCAGTTCGTGGACGTGGACGACGCAACA
GCAGCCAAGCCCCAGCAGCTCGAGGAAGGCAGCGCCGAGTACGACCTGGTGGTGACGTCCAACGACCTGATGGTGCAGATCGACGACGAGATCGAGGCCG
TGCACCGCTTCATTGCGGAGACGTACGCCGCCAAGTTCCCGGAGCTGGACTCGCTCGTACCGAACGCTCTGGACTACGCTCGCGTGGTCAAAGCTATTGG
CAACGCGATGGACCTGACGCTCGTAGAGGAGCTGCCTAAACTGCTGCCCAGCTCCGCAGTCATTGGCATTTCCGTCACTGGGTCGGGGACCAGTGGCAAA
CCGTTGGCCCCTGAGGACCTCAAGACGTGCATGGAGGCGTGTGATGAGCTGCTGTCGCTGGAGAAGGACAAGAACATGATCCTGCGCTTCGTCGAGAGCC
GCATGAAGTACTTGGCGCCGAATGTGTCGCAGCTTGTGGGCACTCGCATTGCAGCGCAGCTCATTGGACTTGCTGGTGGTGTCGCGCAGCTTGCGAGGAT
CCCGTCGTGCAACTTGCAGGTGTTGGGGCAAGAGAAGAAGGTGTTGAGTGGGTTTTCTTCCGCTGCTGCATTGAAACATACGGGCGTCCTGTTCTTCAGT
GACCTGGTGCAGAGTATGCCCCCCTACTTGCGCATGAAGGCGTGTCGAGCTGTCGCTGGAAAGCTAGCGTTGATGGCGCGCGTGGACAGCCAGCCGCACC
AAAATGACACGGAAGGTCTCGTGGGTGCACGCTTTCGGACTGAGCTAGTTGGTAAAATGGAGAAATGGCAGGAACCTCAGAAAGCCAAGACGAAGAAGGC
ACTGCCGATCCCAGACGAAAAACCGCGACGTAAGCGCGGTGGCAAGCGCTACCGCAAGATCAAGGAGCGGCTGCAGATGACGGATGTACGCCGTGAAATG
AATCGGCAGTCTTTCGCGACAGCTGACGAAGAGTATGGTGACAACGCCATGGGAATCACATCCGGCCGCCTTGGCCAGGAAGGATCGGGCAATTTGCGAA
TTATGCGCAAGGAACAGAAGCAGTCGAGCAAAAAGCTGCGTGCCGCGAACTTTGCTGCGTCGTCCGCTAGCAAGCCACCGCTTTCTGGATTGGCATCGAG
TCTTGCCTTCACACCCGTGCAGGGTATTGAGCTGATGAATCCTGAAGCTGCAAAGGCTCGTGTTGCGGAAGCCAACAAAAAATACTTTTCAGCTGCTAGT
GGGTTTGTGAGCGTCGTCAAGAAGCCGTAGA