Description :
From Genome Similarity Track
Location :
Scaffold_4:440259- 445202
Transcript NameFunction/comments
Physo_128239hypothetical protein
Physo_128240hypothetical protein

Sequence
4943 bases(100 bases per row)
GACCCTCACTTGGAGCTTCGGCCCACTTGCCATTCATCAACTCACTCGCCAGCTCAACCATAAATTGCCGATGGGGGTCGCGCTGTGTTGCATCTTGTTT
TGCTAGACGACACGTTAGATACGCATTCGATCTCGCTACATCGATCAGCGCCAGAGCTAGCTTTTTATGCCACCGTTTGAACGAGTGGCCATCTGCGATA
GAAAACCTGGCGCGTGTCTGGTCTAACCGGTCGACACCTTGCATATTCTTGTTATATTCGCCAATGCACATGGGGGCAGGAAATTCGCTTGAAGTATTTC
CTACCATTCTCGAGACAGGTGTAACCGTTGAAGCATCAGCATTTGACAGCATGTTCACGACATCTCCATCGCACCAAGATGCTGCGATCATGCTGTAGTC
ACCAGCGATTGCCTGCCGATGATCCCCTCGAGAACACTTGGTTTCATCAAGAATAGTGTGGCGCGGGAAGTGCTTGCTGTTCGTTTTGATGGTAGCACGA
CCGTACAAGCCTTTAAGCTGAAGTTCTTGCAACAGTTGAACAGAAGTGTAGTAATTGTCCATGTTCACAATACGTCTGGTACCAAAAAATGGCCGCACGA
CCTCCAGCACATGCTGGCGAATTTTCGATACGCTATCAAACTCATCTCGCAGTTCTTGTGTCTCTGCAGCGCCGACGACGCCGTCAAGACGATCACCAAT
ATCACATCTGTTGCTTCGAGTCGAGTAGCTACACCACGAATTCGACCTGGCATCGAGCTTTCTCCATCGGTTGATACCCCTACTAGTAGCTGCCTCCATG
GGAGCCAACGCGTCGAGAAAGGTGGACATAGTCTCGAACATTCGTTCGCCCGTGTGCTCTTCGTACAATGGAACTGCCATCAAATGAAAATTATAGAGCA
CTCCTTTAATAGTAAATCGAGCACGGATGTCCAGATACGACTTTCCATGTAAAGTCGATGTGTCCAATGCAATTGAAAACCCCGTAACAGCATCGAGCGC
CAAGCTAATGAACTGGAGGGAAGCTGCACACAACACTCGGACACTGTTTGACACCATTGTGTCAGTACTGCCTGTATACACCGAGAGACCCGTTTCATCT
CGCACGAATTGGGCAATATCCGCAGCCATTCGAAATGAAGTTCCTCTCTCGACAAGGCCCGCCAAAAGGTAAAAGCGTTTCTGATTTGTGATCGTGGCTG
TGTATTCAACCACTCCTCCATCACTACCCAATGTTCGATGAAATAGACTCAATGCTCGAGAATGGGTGACCTCTCCAATACTATCAGGGTGAAAAAAGTA
GATCGCCGATAATGGTATCCACAATCGATGACTTCACGTGGACAACCAAAGCATCTTGCGAAATGTCGAAGTGGGCGTGAAGCGACTGGGAAACAGGCAC
AACCAGCGAAGATCCGAAAAAGGCTTCTTTTTCCTCGGTGGTTCTGAGAAGGTCGAAGGCAGCCCATTTGGCAGGATGCTCGAGCTCGAGATGCTGTTTG
TAGCATGTGGGTCGAAATGTCTTGAAATACTTCACATTTTCCGTCTTCTTTCGGGGTTTGGCATTGGTGGAAGTTGGTTTCCGTTCTTCGCGCTTGAAGA
CGTCGCAGAATCGGCATTTTACTGACGTGATGACTCCATTAGCGCCCCAAGAGGTCGGCACCAGACCGTAACGCATGGCATGCTGAGGTTCGTACGGACG
AACCGTTTTCTTTGATTTCTGCTTTGGAGGCTCAAGGTTGATCGGTGACTTGGGAGGGCGCTTCGGCGGCATTGAAGACAGACAGCGGTAGACAGGATGG
TAGCGGGGCGAGCTGTGATGGCCAGGGGATAATGCTACTGTATTCTGCAAAACCGACCGAAAAGTCGCAAAATGACAAAGTCACTGTTCTTGGAAAACAA
CAAAAAATCACAAATGTGGTTTCTGTAGTTGCCCCCATATACTCAAATCATATGTACTTACAGTAGCTCTAGCGCTGCTGCAGAATCTGTAGAGCCAATT
CGATGTTGGTGCGGGCCATTTCAAGGAATGACGGGGTTTTCGAGACCGTGTCGAAGTTGCGAAGCGTGAAGGCGAAGCACTCGTCTCGCAGCGACGGAGA
ACTATGTTGGTCGGCTGCCTGGAGGATGCTTGACACGTTGTCCACGCACACTGACTTCAGTAGTTTCTGGGCACAGCGTCGCTTAAGGCTTTCGATGCCG
TACTATTTAGCAAGAAAGCAACATTAATATAAGTGACTTGTTTGAGCTTGAATCAGGGCGATAACCAGACGTACCCGGTCTGCAGCCACAAACAAATCCT
TGACGTCTTTATCAGCAACAGCCAGTCGATCGGTGTAGACGTACTCCAGCAGAGAGAGAAATGTCGTCCAACTGACGTCAGAGATCTTAACTTCAGCTGC
TGTACTCTCCAGCATCTAGACGTCCACCACAAAGCATAGTTATTTGATTAGCTCCACATTTCTTCAAGTAACAAGCAGCAAATGTGTGGGTGGTTAGTAC
TCACCTCTCCGGTGAACATGGCTTTGAAGTAGTTGCAGCGCACGCAAAGACTCTTGTGACCGAAAATCGGCGTTCCTTCGACTGCAATACAACAACAACA
AACGCGTCAGACTTTCGTAAAATACTCAAAGGGAGATGTGCATCTTACCTATGAAAGTGACATCGCTCATGAGTTGGTTGTTGACGAGCGAGCGAAGGTG
AGCCACGGCTGTGCCTTCTTCATCGGGCTCGAGGTCCTCTGGGGTCTTCGATTCGGTCTTCTTCTCTGGCAGCTTCATCTGCTTGAAGCTTACCGCATCG
CTGTGGTTACTCAAGACTAACAAGTTGCCGTCATACACGCACCCTGCAGGCGCATTGCTCTTCGGACCGGGGCCTTCGTAAGCAACGGCCGTCCAAGTGT
TGGATTCTGTCAGCACAAAATAGTGTTAAGTTAGCAATCCCTTTGTAAACAACACGGTAGCGAGCCATAGTCGTACCAAGATCGAGCTCATACAAGTTCG
GGTCAGTCTTCCCACCAAACACAAACAGAGAGTTGTTGTGCAGAGTTACGAGCGGGTTCTGGCAGCCTGCTGGGGGCGTGCCCTTCGTCTCCAAACTCGA
CCAAACTCGGCTCTCTGTTGACATTACACCGCAAAAAGACCACGAGCAGTCAGATTCAGTCCTCTATGCAGAAGACAGAATAGAAAAGGGAAAAGGAAAC
TATGGTGATTCGCGTACCAAAGTTGAAGACGTGGACGTCGTTGAGGTAACCCAGGTCGTGGTCGTATCCTCCAAACAACAAGCAGTTTTGGTTGTGGGCA
ATCATCGAAGCCCCCTCTCTGATGAAAGACAAGCAAATTAATACAGATATTCCAGCAAGCCTGCGCATGAAGATTTTCCCTAACTTACCGAGGGTACGGC
ACTTCTCCGCTGGTACGAACCAACGACCACGAGTTGGTTTCTGTCGCAGCGACGATACTGGGGTCAGTAACTTCACGCAGTCAGATAAATACTCACGACC
ACGTACCCAAGTTAAACGAGTGCATGTCGTTGACATGTCGACCAGAGTCCAGTCTTCCATATTCACTGGAGCTGCGACTTGACATGGACTCGCGATCGTA
GTGACTGTCACTTCCACCGAAAATGTACATGGCGTTGTCTAGTTAAACACCAAAGGTTAGACCAATAACCTTTATCTTCAAATGCGCCAGCGGTTCAACG
CTTACCACAGACCACAGCGGCGTGGCCGTATCTGGGCGTCGGCTGCTGTCCGGCGTTCACAAACACGTTGGTCCAGTTCTGCGTCTCTGCATTCCCACAA
TTCCATCCGCGTCAAACAACAAGCCTCGATCGCCAATACACAGGGCGCGCAGCTTACGGAAGTTGTAGGAGAAGAAGTCGTTCAAGCGCCTGTCCCCATC
GTATCCACCGAAGACGTAGAGCGAGTCCTTGTAGACGACGCCGGAGTGGCTCTTGCGCGGACTCGGACACACGCCGTTACCCGGGACAGTCGACCACTCA
TTGCGAGCGAAGTTGAACTCGAAGAAGTTGTTGTACTGGCGGATCACCGAGCTGCTGCGTGTCGGAGCCGCGGGAAGGTTGCGCTCTGCAAACGAATCAC
GCACGCGATCAGTTAGAAGATAGCCCACCCTCCTACAGAGATGCACTCGTCGTGGTCCGCCCTACGGAGGGGCACAGTCTCACCTCCGAAGATGTAAAGC
GAATCCTTGCGCACGGCGCAGGTGTGGCCGGGGCCAAGCAGCGGCGCCTCTCTCGGGTTCACGCAGCGGACCGTGGTCCACGCCGGTCGGTCGACTTCTT
CGGAGCTTGTCATTTTACTGAGTGGGTGGGTGGTTGTTGCTGTGTCCTCCCTCGGACTATCGGACGCGAATCAAAAGTGCACAAACTGCGAGGACACGTC
AATACGTTAGAGAGCGTCGTCCGGTCGAAGGGCTCGGCCTGACCTCCGTCGGAAGCGCTTGCTTGTCAAGAATATCACCTGCACATCAGTTGTACACAAA
CTTCGTAAAAAGTTTTGAGTAATTACCCCCCCATCTAGACCCATTCTAGTGTACCAGATCTGGCAGGGCCTGCTGCCTGACTTGCTTCTTGCTCTCTCGC
TAACCTGAATACATCTCACTTTCCAATCATCCCTACGTCTACGTCTTCCTTCTCTCCCGTCTTCGACCTGCGCAAGTGCTCAAGCTGATGGCTCGACAGG
TTATAAGCCCAACGATAGGGAGAAGCGGGGAAGACTTCCCACGCCTCAACGGCTCCAACTTCCCAGTGTGGAACGCTCGCATCCGCGCAGCTCTCGACGG
TCAAGACCTGCTAGGCTTCATCGACCAGGAGGACTACGACGGTGACTCGGACTCGTCCATCGTCGACTCCGACGACGACCAAGACCTCAAGCCTTCCCAC
CCACCTTCGCCCACCAAGTCGGATGACCTGCTCTCCGACACCG