Description :
From Genome Similarity Track
Location :
Scaffold_10:440250- 442879
Transcript NameFunction/comments
Physo_130166loricrin-like
Physo_130167hypothetical protein

Sequence
2629 bases(100 bases per row)
AGTGGATGAGCCAGCTCCGGACGCCGACGCCCGACGTGGCGCTCTTGCCGTCGCCCTACGACTTTAACAAGGACACCCCGACGCCCATGGACACCAACAG
CATGGACATGCGGCGGCTGCAGGACGCGCTGCTGCCCACCCCGCCGCCGGACGTCCACGACCAACGCCAACACCCCAAGAACTCGGCGTACGTGACAACA
CGTGGGCCTCGCCCGCTGCTCGAGGACATCGCGTCCTTGTGCCGTGATTTGAACTCGCAGGATCTTTCGGCCGCTAATAAGGGAATGCTGCCGTCGTCTA
GTGGACAGATGGAAACCAAGTACACGACGCTGCCGGCAAGGCCGCTGCGTGCTCGGGAGGAAAGCATCAGCAGCGCCTACTCGGACGACGGAGACAGTCA
AGCCAAGGTGCTCGCGGCGGCTGCAGCTCTCAGCAGTGTGTCGTCCATGGGAGTCGCCAGTACGCCGACGGCTGGATCAGGAACCAAGGGCAAGCGACGG
AAGATGTGCACGGCTGAAGGCTGCCAGAACTTGTCGCGCTCGCGAGGACTGTGCAAGGCGCACGGAGGAGGCCGCCGCTGCAGTGTTGAGGGCTGCTCGC
GCGCTAGCCAGAGCGGCAGTCTGTGCATTACCCACGGAGGAGGCAAGCGCTGCACTGTCGATGGCTGTGTGAAGGCGGCGCAGTCGCGCGGTATGTGCAA
GGCTCACGGTGGAGGTGTTCGCTGCCGTGTGGAAGGATGCTCCAAGAGCTCGCAGGGCGACGGCTTCTGCCGCTCGCACGGCGGTGGTCGTCGCTGTGGC
CACCCCAGTGGCTGCTCCAAGTGGGCGCAGCGCAACGGCATGTGCATGGCGCACAGCGAAGGTAAGTACGGCAACAGCTACCGTGGTCGGCAGCACCGGA
TGGAGCAGCAGGAAGCCGTGGTCCAGCAGACCTGAGTGTGAGCGCGAGGGCAAAGCGCACACTGTTTACCACGATCGAGGAGCCAGGAGGTTTTTGCCAG
CGAATCGACTGGGGCGCATGAGCCAGCAGTACCAAACGAGGAGATTGATGAAGGCAGCGAGGTCTCCCCTCGCACTATTGAGGGAGCAAGCATCAAGCCC
ACGAATGAAGTGGGCGGTCTGCTTGATTAACTGTTGGTAGTCCGGCAAATGACCGACGAGACGTAGCGTCGCATTGTTCACTTGTATACATTACTCTTTA
AAGTTCTGTCTGTTTCGGTTGGAAACACGAGTGCGACCACGAGGTCTGTCGGAGCCAAGATGCATGCCAACGCTGATGAGTCTGGTCTACTTCAACTTGA
CGCTGGGCCTTGATCACCGGAAAAGCTGCACCACCTGATTAAAATTTTAATCGCGGAACGTCAGGTACTGGACATGTAGATGAATGCTTGCGCCCGACTC
AGGGGGATCAGGTACACGCTTATATTATCTTTATCTGTAGAGGAAGGGGTTCAACACAGCCACCAATACGTTACGAGCCCTTTAGTGATCTTCGTAGTAA
GCTACGCGCGCATCAAGCGCAGCGCCAGCGAGCCAAGTCGATGGGCGGCGAAGACCGCGTTTGGGACTGCGAACGTGGTTGTAGCTGTCGACGCGAGCGC
TTACACGCGAATAATCCGGTTTCTCGTCGTCGATCAGGTGCACGGGGCACGCTGCTCGAGTGCCGATTTTGTCCAGCGTCTCGAGGGAAATGAAGGAGTT
GCGCTTGAGCTGGCCCTTCGGGGGCGGCATGCCTGGGTCGGCTTCCTCGCGGTCACAAAGATCGTCTTCCCACCTCTCGGGAAAAGCAACGTGCTTGATA
CACACGCTCAGCGGTCTTGTGCCTAGCTTCATGTCGCTCCTGTATGCAGCAAAACATAGCACTGTTAGAGCAAGTTTCAGGATTGGAGGAAGGCTAGGTA
GACGTACACTCGGTGATAGGCGTCCGTGAGGATCGTCGGCCGCACGAACTTCTGCTTGATCTTCATCCGTGATGAGATGGTGCCCATACTCTTCTTGCGC
TGCACCTCGGGTGTATTCTTGAGAGCCGTACGCCCCGCAAGGCCACCGCCGCGCAGTAAATTCTTCACCGTCGCGAACGTGACGGATCCTCGCGATCGAC
CCATTGGATCTTGGCGCAGCACGCACGACTTCTTCTTGCTTGAGCGTCTCCGCTGCGTCGTGCCAGCTCGCGATGCCCGGAGCTCACTAAATTCATCACC
GCTGTCTGGTCCTTCCGATTCTCCACCGGTAGATGCTGCATTACCTCGAAACCACAATGGATTGGATCCAAGTGGCCGGTCTTGTGGAGAGCTGGCCGGG
TCGTTAGCAGTACCGGATTCATTCGCCAGCCCGAAACGGTTTAGAGAATACAAGAGCTTGTGTAGCTCGGAATCTGTAACGAGCGGGTTCATCGACTGCT
GTTGATCTCGAACTGAAGGAACCGTCGACGCATCCGATTCATAGCTGGACTGCCGCTTCAAAATGCCTCGAGGGACAGATGCAGGGGCTGCGAAGGATAC
TGTGCGACCTGGAGCGTATTGGGGTGATACTGGAGCTGACTGCGACGACTTGAATGGAGAAAAGCCTCCGTGTTGGTCTCGATATCCGTAGGTGCCTGAC
GGGTCGTCCAGAGGTAGTTCACCTCCCTT