Description :
From Genome Similarity Track
Location :
Scaffold_545:4402- 5866
Transcript NameFunction/comments
Pytar_ATCC12531fgenesh_masked-par_contig_545-abinit-gene-0.19Golgi reassembly-stacking protein
Pytar_ATCC12531maker-par_contig_545-snap-gene-0.7Sel1 domain protein repeat-containing protein

Sequence
1464 bases(100 bases per row)
GATCCTTGATAAAGGAACGTGAGCGCAGGATTCCTCTCACGCACGTCGCGTCGTCTGTGACTTGAGGTTGTAGACCTCGAGCTCCATGGGCTGCTCCTCG
CTCTGCGCGATCAGCTCCATGAACGTCGAGTCGCGCGTGTCCTGCATATGTCCATAGAGTCATCGTGTGGTGAGACCCACGCTCCAACAGGCATGACGAA
GCGCCCCCACGTACGAGGCGGATGCCGTTGGCCGAGAGGATAAAGTCGAAGAAGCTCACAAAGCCCACGCGCGAGGCGGGCGACTGCTCCTGGATGCCCA
GCACGCGGAAGCCGCAGAACTCGGCGGCTGCCTCGTCTATATCCTCCACGNNNNNNNNNNCCGCCATGGTCCACGCGCTGCGCCAGCAGCGCCGCCTCAT
CCGCATCCACGCTCGAGCTGTCGTTCCCCATGATTCGTCTGGATGTACACTCGTGCCACGTAATGTCACAAGGGCTTCTATGACACTATTGCGAGGTATT
GGGATTTGACTACCCGGTAGTCACATTCTAATGCAACATGGCTACATTTCATCCATTCTTTATTCGTCGTCGCTGTCCGATCCGTCGCCATTCTCCTCTT
GCTCCATCTTCTGGAGCATCTTGAGGATCGACTCGGCCGTGGCCTTGTTCTGCGGCACGCCCTGCCCGAGGTAGTACATGTCGGCGAGGTTCTTCCAGGC
CTCCATCGAGTCGCTCTCGGCCGCGGCCTGGTAGTACAGAAACGCCTTGGTGTAGTCTTGCTTGACGCCGTCGCCATTGTAGTAGAGCGCACCGAGGCAG
CAGTACGCCTCAGCGCTGCCGGCCTCGCCAGCGGCCTCGTAGAAGTCTTTGGCCTGCTTCAGGTCTTTCTCAAAGCCGTCGCTGCCGTGGTAGTAGATAT
CCGCCATGCAAAACATTGCGTCTTCGTCGCCGCCCTCAAGCGCCTCGTCGAGGTAGCGGAGAAACTTCTCGTGGTCGGGCGCAATGCCGTTCTCTTCATC
TCCCGAGCGGTAGAGCTGCGCCAAGTAAAACTGCGCGCCGGCGTGCCCGCTCTCGGCGCTCTTCTCAATGAGCATCACGGCCGACGTCGCGTTCGGCTCG
ATTTCGAGTTCCTCGTCGCCCGTGTGCAAGAGCTGGCCCATGAAGAGCTGCGCCGACGCGTCGCCCTCCTCGGCGGCTCGCACAAAGTACGGAATCGCGG
CGCCGCGGTTCGGTGGGAACGGCGGGTCGGCGTCCTCGACGCCCTCAAACAGAATCATGCCGATATTGAACAGCGCGTCCGGGTGCGGCTCCGTCTCGAG
CTTGGGCGGCGTCACGCGAAAGTACCAGTCGAGCGCGTGCTGCACGAGCGGTGGGTCCTGCTCGAGGCAGATGTTGCCCAAGTAGACGTGGGCGTCTTTG
TGGCCGTTCGCGGCCGCGCGCCGCATCCACTCGACGGCCTGCGTCGCATCGCCGCTGAGCTGTG